Purpose
To test whether single nucleotide polymorphisms (SNPs) of the 4 vitamin D family genes ( DHCR7 , CYP2R1 , CYP27B1 , and CYP24A1 ) previously associated with several autoimmune diseases are associated with ocular Behçet disease, Vogt-Koyanagi-Harada (VKH) syndrome, acute anterior uveitis (AAU) with ankylosing spondylitis, or pediatric uveitis in the Chinese Han population.
Design
Prospective case-control study.
Methods
Genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism, and the genotypes were verified with direct sequencing. The first-stage study comprised 400 ocular Behçet disease patients, 400 VKH syndrome patients, 218 AAU with ankylosing spondylitis patients, 400 pediatric uveitis patients, and 600 healthy subjects from Chinese Han populations. The second stage included 427 ocular Behçet disease patients and 1000 healthy Chinese Han subjects. Allele and genotype frequencies were compared between patients and controls using the χ 2 test.
Results
In the first-stage study, only the frequencies of the rs12785878 DHCR7 genotype TT and T allele were significantly higher in ocular Behçet disease patients ( P = .036 and P = .008 with Bonferroni correction, respectively) compared with controls among 6 SNPs. No associations could be detected for VKH, AAU with ankylosing spondylitis, or pediatric uveitis. A second stage and combined study confirmed the association of rs12785878 DHCR7 TT genotype and T allele with ocular Behçet disease ( P = 3.28E-04 with Bonferroni correction; odds ratio, 1.506; 95% confidence interval, 1.248 to 1.818; and P = 2.82E-05 with Bonferroni correction; odds ratio, 1.339; 95% confidence interval, 1.188 to 1.508, respectively).
Conclusions
This study provides evidence that the DHCR7 gene is involved in the susceptibility to ocular Behçet disease.
Uveitis is an intraocular inflammation that can be caused by infectious as well as noninfectious mechanisms and is one of the main global causes of blindness. Uveitis can be manifested as an isolated ocular disease, but also can belong to one of the symptoms of a systemic autoimmune or autoinflammatory disease, such as sarcoidosis, Behçet disease, Vogt-Koyanagi-Harada (VKH) syndrome, or acute anterior uveitis (AAU) with ankylosing spondylitis. Many of these uveitis syndromes are caused by an aberrant innate or adaptive immune response and have a genetic background.
Immunogenetic studies in uveitis have focused on genes of the HLA system and cytokine genes, but little attention has been paid to the genetic control of the interaction between the immune and endocrine system. Within the endocrine system, evidence is accumulating for a role of vitamin D deficiency in several autoimmune disorders, including type 1 diabetes mellitus, multiple sclerosis, Crohn disease, and rheumatoid arthritis. 1,25(OH) 2 D3, as the final active metabolite of vitamin D, can inhibit Th1 and Th17 cells, which are believed to have an important role in the pathogenesis of autoimmune and autoinflammatory disease. Serum levels of 1,25(OH) 2 D3 were found to be decreased in uveitis patients with Behçet disease, VKH syndrome, and AAU with ankylosing spondylitis, suggesting a role for 1,25(OH) 2 D3 in their pathogenesis. In a recent study using lymphocytes obtained from ocular Behçet disease patients, we showed that vitamin D3 inhibits Th1 and Th17 differentiation, but upregulates interleukin 10. In view of these findings, we decided to investigate the role of polymorphisms in a number of genes involved in the synthesis and metabolism of vitamin D3 on the development of Behçet disease. As a uveitis control, we included patients with other uveitis entities, including VKH syndrome, AAU associated with ankylosing spondylitis, and patients with pediatric uveitis.
It is well known that choosing preliminary candidate single nucleotide polymorphisms (SNPs) is critical for a candidate gene association study. So, our chosen strategy was based on previously described associations in various autoimmune diseases. Nine SNPs involving in 4 vitamin D metabolism genes were chosen in this study. These SNPs were reported to have association with 1 or 2 autoimmune diseases such as type 1 diabetes mellitus, multiple sclerosis, and autoimmune Addison disease in the previous studies.
Methods
Patients and Healthy Controls Study Populations
This was a prospective case-control study. The study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Chongqing Medical University, Chongqing, China (permit no.: 2009-201008). The tenets of the Declaration of Helsinki were followed in all procedures. Written informed consent was given by all participants for this study. This study is registered in Chinese Clinical Trial Registry (registration no.: ChiCTR-CCC-12002184).
A 2-stage case-control association study was performed. The first-stage studied group comprised 400 ocular Behçet disease patients, 400 VKH syndrome patients, 218 AAU with ankylosing spondylitis patients, 400 pediatric uveitis patients, and 600 healthy subjects who were referred to the Zhongshan Ophthalmic Center, Sun Yat-sen University, and the First Affiliated Hospital of Chongqing Medical University, Chongqing, China. The second stage included a total of another 427 ocular Behçet disease patients and another 1000 healthy controls. The analyses of stage 1 and stage 2 were independent. All control subjects, who were enrolled from April 2005 through February 2013, were matched ethnically and geographically with the patients. The patients with ocular Behçet disease fulfilled the criteria of the International Study Group. The clinical features of these patients were recorded during the entire course of follow-up and are summarized in the Results section. The diagnosis of VKH syndrome was based on the First International Workshop criteria for VKH syndrome. The clinical characteristics of the patients are presented in Supplemental Table 1 (available at AJO.com ). Pediatric uveitis was defined as uveitis (including anterior uveitis, intermediate uveitis, posterior uveitis, and panuveitis) first presenting before 16 years of age. Juvenile idiopathic arthritis was one of the most extraocular manifestations in pediatric uveitis. Among the 400 pediatric uveitis patients, 7.3% had juvenile idiopathic arthritis. The clinical characteristics of patient groups with pediatric uveitis and acute anterior uveitis with ankylosing spondylitis are shown in Supplemental Tables 2 and 3 (available at AJO.com ). Pediatric patients with Behçet disease, VKH syndrome, or definite infectious uveitis were excluded. To obtain a comparable genetic background, we strictly chose the cases from among Chinese Han descendents.
Single Nucleotide Polymorphism Selection and Genotyping
Based on previously reported disease association studies, we selected 1 SNP (rs12785878) of 7-dehydrocholesterolreductase ( DHCR7 ); 2 SNPS (rs10741657 and rs12794714) of cytochrome p450, subfamily IIR, polypeptide 1 ( CYP2R1 ); 2 SNPs (rs2248359 and rs2762932) of cytochrome p450, family 24, subfamily A, polypeptide 1 ( CYP24A1 ); and 4 SNPs (rs10877012, rs118204009, rs118204011, and rs118204012) of 25-hydroxyvitamin D3-1-alpha-hydroxylase ( CYP27B1 ) as our candidate SNPs to explore the possible association with ocular Behçet disease, VKH syndrome, AAU with ankylosing spondylitis, and pediatric uveitis.
Genomic DNA samples of the healthy controls and patients with ocular Behçet disease, VKH syndrome, AAU with ankylosing spondylitis, and pediatric uveitis were extracted with the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, California, USA). The genotyping success rate for the various SNPs ranged between 97.4% and 98.9%.
The primers of rs12785878, rs10741657, rs12794714, rs2248359, rs2762932, rs10877012, rs118204009, rs118204011, and rs118204012 for amplifying target DNA sequence by polymerase chain reaction are depicted in Table 1 . The formed digestion products were separated on a 5% agarose gel (1 SNP, rs2762932) or 4% agarose gel (another 8 SNPS) and were stained with GoldView (SBS Genetech, Beijing, China). The restriction enzymes were purchased from Thermo Fisher Scientific (Shangai, China). Using randomly selected subjects (5% of all samples) to check the result of the polymerase chain reaction-restriction fragment length polymorphism method used in our study, direct sequencing was performed by the Majorbio Biotechnology Company (Shanghai, China).
| Gene | SNP ID | Primers | Restriction Enzyme | Lengh of the target segments (bp) |
|---|---|---|---|---|
| DHCR7 | rs12785878 | 5′ ACCACCTTCAAATAGGGCTGT 3′ | TaqI | 271 bp (151 + 119) |
| 5′ CAGCAGACAGGACATGAGGAT 3′ | ||||
| CYP27B1 | rs10877012 | 5′ AACATAGTCGAACTGTCTCTAC 3′ | HinfI | 298 bp (195 + 103) |
| 5′ TTCAATTCCAGAACTTCAGAGC 3′ | ||||
| rs118204009 | 5′ T GTGCTTTGCAACCTAGACTGT 3′ | BssSI | 281 bp | |
| 5′ G GAAGTTTTCTGGGGCTACTTT 3′ | ||||
| rs118204011 | 5′ TTCACATGTTTTTCAGGTGTCC 3′ | BsmI | 279 bp | |
| 5′ TT CTCTGCTATCTCCCTGCTTC 3′ | ||||
| rs118204012 | 5′ ATGCGCACTCTCTCCTCAAC 3′ | MluCI | 248 bp | |
| 5′ CTCTGTCCTGGGACTCACCTT 3′ | ||||
| CYP2R1 | rs10741657 | 5′ G GGAAGAGCAATGACATGGA 3′ | MnLI | 288 bp (151 + 105 + 32) |
| 5′ G CCCTGGAAGACTCATTTTG 3′ | ||||
| rs12794714 | 5′ CCATAAGTCCAACCAGGAAGG 3′ | FokI | 299 bp (161 + 137) | |
| 5′ AGCTTTGGAGAGCTGAAGA GG 3′ | ||||
| CYP24A1 | rs2248359 | 5′ TTCTACACCGACTACCTTGTGC 3′ | SacII | 191 bp (134 + 57) |
| 5′ CAAAAATCTCCAACTTCCGTTC 3′ | ||||
| rs2762932 | 5′ CCTACATACTAACTGTGATTCTAAGGAGGT 3′ | BstEII | 204 bp (176 + 28) | |
| 5′ GGCCAATGTGGTCATGATGATAAT 3′ |
Statistical Analysis
The χ 2 test was used to estimate whether the data conformed to the Hardy-Weinberg principle. The patterns of linkage disequilibrium of the SNPs (rs10741657 and rs12794714) of CYP2R1 and the SNPS of CYP24A1 were compared using Haploview 4.0 (Daly Lab at the Broad Institute, Cambridge, Massachsetts, USA), except for the SNP (rs12785878) of DHCR7 and the SNP (rs10877012) of CYP27B1 . Direct counting estimated genotype frequencies. The χ 2 test using SPSS version 17.0 (SPSS, Inc, Chicago, Illinois, USA) was used to compare allele and genotype frequencies between patients and controls. The P values were subject to Bonferroni correction by multiplying with the number of analyses performed. The Bonferroni corrections were based on a number of 18 independent comparisons.
Results
We found a significant association with a polymorphism for the gene encoding DHCR7 in ocular Behçet disease patients, but not in the other uveitis entities studied. No association was found with polymorphisms for the genes encoding CYP2R1 , CYP24A1 , or CYP27B1 .
Association of the 4 Vitamin D-Related Gene Polymorphisms with Susceptibility to Ocular Behçet Disease
Gene polymorphisms were not observed for 3 SNPs (rs118204009, rs118204011, and rs118204012) of CYP27B1 in the tested Chinese Han population. A total of 400 patients with ocular Behçet disease and 600 healthy controls were genotyped for the other 6 SNPs: 1 SNP (rs12785878) of DHCR7 , 2 SNPS (rs10741657 and rs12794714) of CYP2R1 , 2 SNPs (rs2248359 and rs2762932) of CYP24A1 , and 1 SNP (rs10877012) of CYP27B1 . These 6 SNPs were genotyped successfully and conformed to the Hardy-Weinberg principle in controls. Frequencies of the rs12785878 DHCR7 genotype TT and T allele were significantly higher in ocular Behçet disease patients ( P = .036 with Bonferroni correction; odds ratio [OR], 1.550; 95% confidence interval [CI], 1.169 to 2.055; and P = .008 with Bonferroni correction; OR, 1.382; 95% CI, 1.155 to 1.655, respectively) compared with controls. The uncorrected P value of the GG genotype of rs12785878 DHCR7 was .006 (< .05). However, the significance was lost after Bonferroni correction. Then, we replicated the associated the SNP rs12785878 of DHCR7 using the other cohort that included 427 cases and 1000 controls. The results showed that frequencies of the rs12785878 DHCR7 genotype TT, GG, and T allele were significantly higher in ocular Behçet disease patients ( P = .012 with Bonferroni correction; OR, 1.450; 95% CI, 1.124 to 1871; and P = .009 with Bonferroni correction; OR, 0.672; 95% CI, 0.518 to 0.872; and P = 0.003 with Bonferroni correction; OR, 1.270; 95% CI, 1.082 to 1.492, respectively) compared with controls. In the combined stage, after combining the number of ocular Behçet disease cases (n = 827) and healthy controls (n = 1600), we confirmed the association with the rs12785878 DHCR7 genotype TT and T allele ( P = 3.28E-04 with Bonferroni correction; OR, 1.506; 95% CI, 1.248 to 1.818; P = 2.82E-05 with Bonferroni correction; OR, 1.339; 95% CI, 1.188 to 1.508, respectively; Table 2 ). No significant differences were found between patients with ocular Behçet disease and controls concerning the frequencies of the other 5 SNPs ( Table 2 ).
| SNPs | Stage | Genotype Allele | Cases, No. (Frequency) | Controls, No. (Frequency) | P Value | P c Value | OR (95% CI) |
|---|---|---|---|---|---|---|---|
| rs12785878 ( DHCR7 ) | First a | TT | 129 (0.323) | 141 (0.235) | .002 | .036 | 1.550 (1.169 to 2.055) |
| TG | 201 (0.503) | 310 (0.517) | .661 | NS | 0.945 (0.734 to 1.217) | ||
| GG | 70 (0.175) | 149 (0.248) | .006 | NS | 0.642 (0.467 to 0.882) | ||
| T | 459 (0.574) | 592 (0.493) | 4.18E–04 | .008 | 1.382 (1.155 to 1.655) | ||
| G | 341 (0.426) | 608 (0.507) | 4.18E–04 | .008 | 0.723 (0.604 to 0.866) | ||
| Replication b | TT | 127 (0.297) | 226 (0.226) | .004 | .012 | 1.450 (1.124 to 1.871) | |
| TG | 195 (0.457) | 480 (0.480) | .419 | 1.257 | 0.911 (0.725 to 1.143) | ||
| GG | 105 (0.246) | 294 (0.294) | .003 | .009 | 0.672 (0.518 to 0.872) | ||
| T | 449 (0.526) | 932 (0.466) | .003 | .003 | 1.270 (1.082 to 1.492) | ||
| G | 405 (0.474) | 1068 (0.534) | .003 | .003 | 0.787 (0.670 to 0.924) | ||
| Combined c | TT | 256 (0.310) | 367 (0.229) | 1.82E–05 | 3.28E–04 | 1.506 (1.248 to 1.818) | |
| TG | 396 (0.479) | 790 (0.494) | .486 | 8.750 | 0.942 (0.796 to 1.114) | ||
| GG | 175 (0.212) | 443 (0.277) | 4.69E–04 | .008 | 0.701 (0.574 to 0.856) | ||
| T | 908 (0.549) | 1524 (0.476) | 1.56E–06 | 2.82E–05 | 1.339 (1.188 to 1.508) | ||
| G | 746 (0.451) | 1676 (0.524) | 1.56E–06 | 2.82E–05 | 0.747 (0.663 to 0.842) | ||
| rs10877012 ( CYP27B1 ) | First | TT | 151 (0.378) | 247 (0.412) | .28 | NS | 0.867 (0.669 to 1.123) |
| TG | 199 (0.498) | 284 (0.473) | .454 | NS | 1.102 (0.855 to 1.419) | ||
| GG | 50 (0.125) | 69 (0.115) | .632 | NS | 1.099 (0.746 to 1.621) | ||
| T | 501 (0.626) | 778 (0.648) | .314 | NS | 0.909 (0.755 to 1.095) | ||
| G | 299 (0.374) | 422 (0.352) | .314 | NS | 1.100 (0.914 to 1.325) | ||
| rs10741657 ( CYP2R1 ) | First | AA | 52 (0.130) | 79 (0.132) | .939 | NS | 0.985 (0.677 to 1.434) |
| AG | 197 (0.493) | 281 (0.468) | .454 | NS | 1.102 (0.855 to 1.419) | ||
| GG | 151 (0.378) | 240 (0.400) | .475 | NS | 0.910 (0.701 to 1.180) | ||
| A | 301 (0.376) | 439 (0.366) | .636 | NS | 1.046 (0.869 to 1.258) | ||
| G | 499 (0.624) | 761 (0.634) | .636 | NS | 0.956 (0.795 to 1.151) | ||
| rs12794714 ( CYP2R1 ) | First | AA | 48 (0.120) | 91 (0.152) | .156 | NS | 0.763 (0.524 to 1.110) |
| AG | 193 (0.483) | 248 (0.413) | .031 | NS | 1.323 (1.026 to 1.707) | ||
| GG | 159 (0.398) | 261 (0.435) | .239 | NS | 0.857 (0.663 to 1.108) | ||
| A | 289 (0.361) | 430 (0.358) | .894 | NS | 1.013 (0.841 to 1.220) | ||
| G | 511 (0.639) | 770 (0.642) | .894 | NS | 0.987 (0.820 to 1.190) | ||
| rs2248359 ( CYP24A1 ) | First | CC | 131 (0.328) | 223 (0.372) | .152 | NS | 0.823 (0.631 to 1.075) |
| CT | 195 (0.488) | 283 (0.472) | .623 | NS | 1.066 (0.827 to 1.373) | ||
| TT | 74 (0.185) | 94 (0.157) | .24 | NS | 1.222 (0.874 to 1.708) | ||
| C | 457 (0.571) | 729 (0.608) | .106 | NS | 0.861 (0.718 to 1.032) | ||
| T | 343 (0.429) | 471 (0.392) | .106 | NS | 1.162 (0.969 to 1.393) | ||
| rs2762932 ( CYP24A1 ) | First | CC | 6 (0.015) | 6 (0.010) | .477 | NS | 1.508 (0.483 to 4.708) |
| CT | 61 (0.153) | 103 (0.172) | .423 | NS | 0.868 (0.615 to 1.227) | ||
| TT | 333 (0.833) | 491 (0.818) | .564 | NS | 1.103 (0.790 to 1.542) | ||
| C | 73 (0.091) | 115 (0.096) | .731 | NS | 0.947 (0.696 to 1.289) | ||
| T | 727 (0.909) | 1085 (0.904) | .731 | NS | 1.056 (0.776 to 1.436) |
a First stage (stage 1), case-to-control ratio: 400:600.
b Replication stage (stage 2), case-to-control ratio: 427:1000.
Among 827 Behçet disease patients, the mean age at onset ± standard deviation was 31.4 ± 9.6 years, 827 (100%) had uveitis and recurrent oral ulceration, 426 (51.51%) had recurrent genital ulceration, 552 (66.75%) had skin lesions, 216 (26.12%) had positive pathergy test results, 193 (23.34%) had hypopyon, and 125 (15.11%) had arthritis. The proportions of anterior uveitis and panuveitis were 14.4% (119) and 85.6% (708) among the 827 Behçet disease patients, respectively. We also studied the association of polymorphisms of the 4 vitamin D-related genes with the clinical features of ocular Behçet disease entities, using stratified analysis. A significantly higher frequency of TT genotype and T allele of the SNP rs12785878 of DHCR7 was noted in ocular Behçet disease patients with recurrent genital ulcers and skin lesions, respectively ( Table 3 and Supplemental Table 4 , available at AJO.com ). There was no significant statistical association concerning the genotypes of the other 5 SNPs and clinical manifestations in ocular Behçet disease.
| SNP | Clinical Features | Genotype | Behçet Disease Patients (%) | Controls (%) | P c Value | OR (95% CI) |
|---|---|---|---|---|---|---|
| rs12785878 | Recurrent genital ulcer | TT | 145 (0.340) | 367 (0.229) | 6.76E–05 | 1.727 (1.370 to 2.178) |
| TG | 187 (0.439) | 790 (0.494) | NS | |||
| GG | 95 (0.221) | 443 (0.277) | NS | |||
| T | 477 (0.56) | 1524 (0.476) | 1.01E–04 | 1.399 (1.202 to 1.629) | ||
| G | 375 (0.44) | 1676 (0.524) | 1.01E–04 | 0.715 (0.614 to 0.832) | ||
| Skin lesions | TT | 172 (0.312) | 367 (0.229) | .003 | 1.521 (1.227 to 1.885) | |
| TG | 252 (0.457) | 790 (0.494) | NS | |||
| GG | 128 (0.232) | 443 (0.277) | NS | |||
| T | 596 (0.54) | 1524 (0.476) | .002 | 1.290 (1.125 to 1.480) | ||
| G | 508 (0.46) | 1676 (0.524) | .002 | 0.775 (0.676 to 0.889) | ||
| Positive pathergy test results | TT | 65 (0.301) | 367 (0.229) | NS | ||
| TG | 100 (0.463) | 367 (0.229) | NS | |||
| GG | 51 (0.236) | 790 (0.494) | NS | |||
| T | 230 (0.532) | 443 (0.277) | NS | |||
| G | 202 (0.468) | 1524 (0.476) | NS | |||
| Hypopyon | TT | 58 (0.301) | 367 (0.229) | NS | ||
| TG | 93 (0.482) | 790 (0.494) | NS | |||
| GG | 42 (0.218) | 443 (0.277) | NS | |||
| T | 209 (0.542) | 1524 (0.476) | NS | |||
| G | 177 (0.459) | 1676 (0.524) | NS | |||
| Arthritis | TT | 27 (0.216) | 367 (0.229) | NS | ||
| TG | 64 (0.512) | 790 (0.494) | NS | |||
| GG | 34 (0.272) | 443 (0.277) | NS | |||
| T | 118 (0.472) | 1524 (0.476) | NS | |||
| G | 132 (0.528) | 1676 (0.524) | NS | |||
| Anterior uveitis | TT | 30 (0.252) | 367 (0.229) | NS | ||
| TG | 57 (0.479) | 790 (0.494) | NS | |||
| GG | 32 (0.269) | 443 (0.277) | NS | |||
| T | 117 (0.492) | 1524 (0.476) | NS | |||
| G | 121 (0.508) | 1676 (0.524) | NS | |||
| Panuveitis | TT | 165 (0.233) | 367 (0.229) | NS | ||
| TG | 341 (0.482) | 790 (0.494) | NS | |||
| GG | 202 (0.285) | 443 (0.277) | NS | |||
| T | 671 (0.474) | 1524 (0.476) | NS | |||
| G | 745 (0.526) | 1676 (0.524) | NS |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
