Mutations in the TSPAN12Gene in Japanese Patients with Familial Exudative Vitreoretinopathy




Purpose


To search for mutations in the TSPAN12 gene in 90 Japanese probands with familial exudative vitreoretinopathy (FEVR) and their family members and to determine the types and frequencies of the mutations.


Design


Laboratory investigation and clinical case analyses.


Methods


Direct sequencing after polymerase chain reaction of the coding exons of TSPAN12 was performed for 90 probands with FEVR and some of their family members. The clinical signs and symptoms that were characteristic of individuals with TSPAN12 mutations were determined.


Results


Three families were found to carry 2 mutations in TSPAN12 . One of these mutations was a new missense change, L245P, and the other was an already reported nonsense mutation, L140X, in 2 families. Mutations in TSPAN12 accounted for 3% of Japanese FEVR patients and 8% of the FEVR families who did not have mutations in any of the known FEVR genes, FZD4 , LRP5 , and NDP . The clinical signs and symptoms varied among the patients, but the retinal findings with TSPAN12 mutations were not different from those with mutations in the known FEVR-causing genes.


Conclusions


Mutant TSPAN12 is responsible for approximately 3% of FEVR patients in Japan. The results provide further evidence that mutations in TSPAN12 are FEVR causing and that the gene products most likely play a role in the development of retinal vessels.


Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder that is characterized by defects in the development of retinal vessels and is manifested by different retinal pathologic features, including retinal folds and retinal detachments. The expressivity of the disease differs widely between and within families. Most individuals remain asymptomatic, and the consistent signs of FEVR are abnormal retinal vessels and avascularization of the peripheral retina.


FEVR is genetically heterogeneous, and 3 genes are known to be responsible for FEVR. Mutations in the genes coding for the Wnt receptor pair, frizzled-4 ( FZD4 ), and low-density lipoprotein receptor-like protein 5 ( LRP5 ), are known to cause FEVR. Mutations in genes coding for the ligand of the receptor pair, norrin ( NDP ), also cause FEVR and Norrie disease (ND). The ligand–receptor complex activates canonical Wnt signaling and controls vascular development in the retina. Mutations in FZD4 cause autosomal dominant FEVR, mutations in LRP5 cause autosomal dominant or recessive FEVR, and mutations in NDP cause X-linked recessive FEVR.


Recently, a transmembrane protein, TSPAN12, was found to be expressed in the retinal vascular endothelial cells and to enhance Wnt signaling through FZD4 and LRP5. This study was followed by 2 studies that demonstrated 9 mutations of this gene in autosomal dominant FEVR patients. Because of our interest in the genetic basis of FEVR, we have examined our Japanese patients with FEVR to determine whether TSPAN12 mutations were present in them. We show that mutations in the TSPAN12 gene were found in only approximately 3% of the Japanese FEVR patients.


Methods


Participants and Clinical Examinations


Ninety probands, 39 familial and 51 simplex, with FEVR and 7 cases with ND were studied. All patients were Japanese and were born at term of normal weight. The diagnosis of FEVR was based on the presence of peripheral retinal avascularization with abnormal retinal vascular changes as well as the other typical clinical signs: severe retinal exudates, retinal neovascularization, peripheral fibrovascular mass, ectopic macula, retinal folds, and retinal detachment. The diagnosis of ND was made for boys who had bilateral retinal detachment or retinal folds with retrolental fibrous tissue and blindness within the first year of life. Ocular examinations included refraction, visual acuity, intraocular pressure, slit lamp, fundus, and ultrasonography. Fluorescein angiography was performed on 20 probands.


Laboratory Studies


Deoxyribonucleic acid samples were extracted from peripheral blood using a deoxyribonucleic acid extraction kit (QiaAmp; Qiagen, Chatsworth, California, USA). To identify mutations in the coding exons (exons 2 to 8) of the TSPAN12 gene, oligonucleotide primers on the flanking intron and untranslated region sequences were designed ( Table 1 ). Polymerase chain reaction and sequencing were conducted as described. The annealing temperature for polymerase chain reaction was 60 C for all exons. After sequence changes were detected in the probands, samples from other family members were analyzed by direct sequencing as well as denaturing high-performance liquid chromatography. Before this study, mutations in 3 genes, FZD4 , LRP5 , and NDP , known to cause FEVR had been analyzed in these patients.



TABLE 1

Sequences of Polymerase Chain Reaction Primers Used to Amplify TSPAN12 Coding Exons














































Exon Primer PCR Product Size (bp)
Forward (5′→3′) Reverse (5′→3′)
2 attGGTGAGATGTCCCGTGTTCT gtTAATGCTTAGCCATGCCCTT 270
3 aTTTCAAGATGCAGCAAATGG GTTGCTATGGGCAGGAAAAA 333
4 atTGCTATGTCTTGGGTGCATT gttAAACGAAAGCGTCCCTTCTT 331
5 aTTTCCCCATCTGCTTCTGAG gttAAAAGGCTGAACTGTTGTTTTAGA 267
6 attGAGCTACAGCTGTTGATATTTTGC gttAAACATCTGGTTTGAAGGTGC 210
7 atTGATGACAGATATAGCTCTGGGT gttGGAAAATTTCATTGGCATATTG 346
8 attGCTTTCCCTGAGAACCACTG gtTGCTTAGGTGTTATTTTATGGCAA 574

PCR = polymerase chain reaction.

The 5′-end of each primer was designed to have an ATT or GTT for postlabeling purposes. When necessary, extra nucleotides (lowercase) were attached.




Results


Two new nonsynonymous sequence changes in the coding sequence of the TSPAN12 gene were found in 2 probands from Families 1 and 2 with autosomal dominant FEVR ( Figure 1 ): c.734T→C (L245P) and c.154G→C (E52Q). L245 is located at the C-terminal cytoplasmic tail region and could provide specific functional links to cytoskeletal or signaling proteins. E52 is located in the short extracellular loop. Both residues and the surrounding regions were conserved in humans and other vertebrates ( Figure 1 ).




FIGURE 1


Chromatograms and pedigrees of 4 families with familial exudative vitreoretinopathy. (Top left) Mutations and nonsynonymous changes in the TSPAN12 genes in patients with familial exudative vitreoretinopathy. Arrows indicate the positions of the altered nucleotides. E52Q is shown in the antisense direction. (Top right) Protein sequence alignment of TSPAN12 with homologues from human and other vertebrates with arrows indicating the amino acid changes. Sequence data were derived from GenBank or SwissProt based on a previous study (Poulter and associates ). Asterisks (*) indicate highly conserved amino acids. (Bottom) Pedigrees of 4 families illustrating the cosegregation of the TSPAN12 mutations with familial exudative vitreoretinopathy in Families 1 through 4. Solid symbols indicate individuals with a diagnosis of familial exudative vitreoretinopathy. Arrows indicate probands. Individuals from whom sequence data were obtained are numbered. A, B, and C indicate the sequence changes L245P, E52Q, and L140X, respectively, which also are indicated above the trace data at the top. Plus (+) indicates a wild-type sequence. Results of denaturing high-performance liquid chromatography (DHPLC) are shown below each genotype. For Family 1, a wild-type pattern of DHPLC is shown in the Inset because deoxyribonucleic acid for an unaffected individual is unavailable. Note that a sister of the proband of Family 2 (filled with gray) was diagnosed with mild familial exudative vitreoretinopathy, but did not carry the mutation in TSPAN12. The mutation in Family 4 has been reported previously.


None of the sequence changes were found in 380 chromosomes from 190 healthy volunteers. Direct sequencing as well as denaturing high-performance liquid chromatography analysis revealed that both changes were transmitted heterozygously and were cosegregated with the disease except for a sister of the proband in Family 2 ( Figure 1 ). This patient was diagnosed with FEVR because of abnormal retinal vessels with vitreous degeneration, but did not have the E52Q change. Therefore, we could not conclude that E52Q is responsible for FEVR.


One recurrent mutation c.419T→A (L140X) also was found in a sporadic patient (Family 3) and in a proband with autosomal dominant FEVR (Family 4). The mutation in Family 4 was reported previously. Subsequent analysis of family members revealed a total of 6 mutations when the E52Q change was excluded ( Figure 1 ). The clinical symptoms varied among the patients carrying the TSPAN12 mutations from mild vascular changes with retinal degeneration to severe bilateral retinal folds ( Table 2 and Figure 2 ). The clinical signs and symptoms of patients with the TSPAN12 mutation were not different from those with mutations in known FEVR-causing genes.



TABLE 2

Mutations in TSPAN12 Gene and the Associated Clinical Findings in Patients with Familial Exudative Vitreoretinopathy





















































































Family ID a /Age (yo)/Sex Sequence Change Visual Acuity (Refraction) Peripheral Avascular Retina Retinal Vessels Abnormality Vitreous Degeneration Ectopic Macula Fibrous Tissue Falciform Retinal Fold Comments
1 II-1/37/F L245P 1.2 (nc) BE BE BE BE No No No
III:1/15/F (proband) L245P 0.06 (−2.5 D) RE; 0.6 (−6.0 D) LE BE BE BE No RE RE PHC LE
III:2/13/M L245P 1.2 (nc) BE BE BE BE No No No
3 II-1/11/M (proband) L140X NLP RE; 0.1 (+13.0 D) LE LE b LE b NA No BE BE VxLx BE at 1 yo, phthisical RE, aphakic BE
4 I-1/42/M L140X 1.2 (−4.0 D) BE BE BE No No No No
II-1/12/F (proband) L140X 0.07 (+18.0 D); 0.1 (+18.0 D) BE BE NA BE BE No VxLx BE at 0 yo, aphakic BE

Only gold members can continue reading. Log In or Register to continue

Related posts:

  1. Association of Lesion Size and Visual Prognosis to Polypoidal Choroidal Vasculopathy
  2. Success Rates of Trabeculotomy for Steroid-Induced Glaucoma: A Comparative, Multicenter, Retrospective Cohort Study
  3. Topography-Guided Conductive Keratoplasty for Keratoconus
  4. Reporting Visual Acuities

Stay updated, free articles. Join our Telegram channel
Tags:
Jan 16, 2017 | Posted by in OPHTHALMOLOGY | Comments Off on Mutations in the TSPAN12Gene in Japanese Patients with Familial Exudative Vitreoretinopathy

Full access? Get Clinical Tree
Get Clinical Tree app for offline access