Purpose
To assess whether the genetic polymorphisms of estrogen receptor beta ( ESR2 ) are associated with primary open-angle glaucoma (POAG).
Design
Case-control study.
Methods
Four hundred and twenty-five Japanese patients with POAG, including normal-tension glaucoma (NTG, n = 213) and high-tension glaucoma (HTG, n = 212), and 191 control subjects without glaucoma were analyzed for polymorphisms of rs1256031 and rs4986938 in the ESR2 gene. The genotypic and allelic frequencies were compared between NTG or HTG patients and control subjects. The phenotypic features of patients with POAG were compared between each genotype.
Results
There were significant differences in the genotype frequencies of rs1256031 and rs4986938 between the HTG patients and control subjects in women ( P = .033 and P = .043 respectively). The frequencies of the C allele of rs1256031 and G allele of rs4986938 were significantly higher in patients with HTG in comparison to the control subjects in women (rs1256031: 53.6% vs 43.4%, P = .044; rs4986938: 89.2% vs 80.6%, P = .027). The maximum intraocular pressures in female POAG patients with the CC or TC genotypes of rs1256031 were significantly higher than that in female POAG patients with the TT genotype ( P = .039, analysis of variance, P = .018 and P = .026 respectively).
Conclusion
The ESR2 gene polymorphism is therefore considered to be associated with an intraocular pressure elevation in female patients with POAG.
Glaucoma is characterized by a loss of retinal ganglion cells, thus leading to optic nerve degeneration and corresponding visual field defects. It is the second-leading cause of irreversible blindness worldwide and it has been estimated that it will affect approximately 80 million people by the year 2020. Primary open-angle glaucoma (POAG) is the most common form of glaucoma and is clinically classified into high-tension glaucoma (HTG), in which elevated intraocular pressure (IOP) is a major feature, and normal-tension glaucoma (NTG), in which the IOPs are consistently within the statistically normal population range. Although elevation of IOP is recognized as a major risk factor for optic nerve damage in POAG, little is known about the pathogenesis and etiology of elevated IOP in patients with POAG. In 1997, the myocilin gene was identified as a gene causing HTG for the first time. Although the exact mechanism is unknown, this gene has been implicated in the pathophysiology of glaucoma by causing obstruction of the aqueous outflow through the trabecular meshwork with its product, resulting in an elevated IOP. However, the myocilin gene harbors mutations in only about 2% to 4% of patients with HTG, which indicates that, without the myocilin gene mutations, other gene mutations or susceptible gene polymorphisms associated with elevation of IOP exist. In fact, the mutations and polymorphisms that are possibly associated with an elevation of IOP have recently been reported.
Estrogens are steroid hormones long known for their profound effects on reproductive systems and the effects of estrogens are mediated by specific nuclear receptors, the estrogen receptor alpha ( ESR1 ) and beta ( ESR2 ). Estrogens bind to these receptors to form an estrogen-receptor complex. This complex can subsequently bind to an estrogen response element on a gene to activate its transcription. Some studies have examined the possible association between menopausal transition or postmenopausal hormone use and IOP, or risk of POAG. Qureshi and associates and Siesky and associates reported that IOP is higher among postmenopausal women than among premenopausal women of similar age, and it was reported that supplemental estrogen in postmenopausal women reduces IOP. Furthermore, Hulsman and associates reported that early menopause was associated with a higher risk of POAG, and Pasquale and associates reported that late menopause was associated with a reduced risk of POAG. These reports suggest that estrogen or estrogen-related factors may play a role in POAG pathogenesis, especially IOP regulation. In 2008, de Voogd and associates demonstrated that 2 single nucleotide polymorphisms (SNPs), rs1256031 and rs4986938, in the ESR2 gene seem to lead to an increased risk of POAG in the ethnically homogeneous Netherlands population. They also reported that the high-risk haplotype showed a 3.6-fold higher risk of incident POAG in men.
This study investigated whether these 2 SNPs in the ESR2 gene were associated with POAG in the Japanese population. Furthermore, the association between these SNPs and the phenotypic features of patients with POAG was also investigated.
Materials and Methods
Subjects
Japanese patients with POAG were recruited from ophthalmology practices in University of Yamanashi Hospital, Enzan Municipal Hospital, Uenohara City Hospital, and Oizumi Clinic in Yamanashi or Nagano Prefectures, Japan. A diagnosis of POAG was made when open angles were detected on a gonioscopic examination and typical glaucomatous cupping of the optic disc (thinning of the optic disc rim and/or enlargement of the horizontal optic disc cupping) with compatible visual field defects (nasal step and/or partial arcuate visual field defect) was detected by automated static perimetry (Humphrey Visual Field Analyzer 30-2, Humphrey Instruments, San Leandro, California, USA). In addition, patients with HTG had evidence of at least 1 previous measurement of IOP that was more than 21 mm Hg with a Goldmann applanation tonometer. Patients with NTG showed an IOP of less than 21 mm Hg each time they were tested (at least 3 IOP measurements before treatment) and no signs of intracranial disease that would cause optic nerve atrophy in x-ray computerized tomography or magnetic resonance imaging. The patients were excluded if they had a history of eye surgery, including laser treatment, before the diagnosis of POAG. Control subjects recruited from the participating institutions were Japanese individuals who were over 40 years of age, had IOP below 21 mm Hg, exhibited no glaucomatous cupping of the optic disc (no thinning of disc rim and cup-to-disc ratio less than 0.4), and had no family history of glaucoma. All subjects received comprehensive ophthalmologic examinations including both slit-lamp biomicroscopy and fundoscopy, and peripheral blood was collected.
Genomic DNA Genotyping
Genomic DNA was purified with a Flexi Gene DNA Kit (QIAGEN, Valencia, California, USA). To assess the association between the ESR2 gene polymorphisms and POAG, de Voogd and associates selected 2 SNPs, rs1256031 in intron 3 and rs4986938 in intron 8 of ESR2 gene (NM_001040276.1), on the basis of their allele frequencies and linkage dysequilibrium analysis. To compare our findings with the results of their study, these 2 SNPs were genotyped using allele-specific primer polymerase chain reaction (PCR) method. The following primers were used for amplification, and the amplification products were electrophoresed with 2% agarose gels, and genotypes were obtained.
rs1256031:
T allele–specific forward primer: AGGGTCTCAGTTCACA G TCT
C allele–specific forward primer: AGGGTCTCAGTTCACA G TCC
Common reverse primer: CAGGCCATTTGTCACTCATA
rs4986938:
Common forward primer: GGCATGGAACATCTGCTCAA
A allele–specific reverse primer: TGGAGTTCACGCTTC G GCT
G allele–specific reverse primer: TGGAGTTCACGCTTC G GCC
Statistical Analysis
Data were analyzed using SAS statistical software (version 9.1, SAS Institute Inc, Cary, North Carolina, USA). A χ 2 analysis of the Hardy-Weinberg equilibrium for ESR2 genotypes was performed for patients and control subjects. Genotype and allele frequency differences between NTG or HTG patients and control subjects were estimated for each gender by the χ 2 test and Fisher exact test respectively. In addition, a logistic regression model was used to study the effects of ESR2 alleles when comparing HTG patients with control subjects in women. At first, the predictor variables were age, maximum IOP, rs1256031 allele, and rs4986938 allele. However, the maximum IOP was excluded in this model because it was not an independent variable for ESR2 alleles. The odds ratio of age is per year. Demographic and clinical features (age at the time of diagnosis and blood sampling, family history of glaucoma, maximum IOP, refractive error, and history of glaucoma surgery) in female patients with POAG were compared between ESR2 genotypes using an analysis of variance (ANOVA) for continuous variables and the χ 2 test for a comparison of proportions. IOP was not adjusted by the central corneal thickness because the central corneal thickness had not been measured. A value of P < .05 was considered to be statistically significant.
Results
Four hundred and twenty-five Japanese patients with POAG (213 patients with NTG and 212 patients with HTG) and 191 control subjects were enrolled in this study. The demographic and clinical data in patients with POAG and the control subjects for each gender are shown in Table 1 . The mean age at the time of blood sampling was 63.4 ± 14.3 years (standard deviation) in patients with POAG and 65.7 ± 11.4 years in the control subjects. The mean of maximum known IOP was 23.5 ± 8.2 mm Hg in patients with POAG and 15.0 ± 2.7 mm Hg in the control subjects. The genotype and allele frequencies of ESR2 gene polymorphisms (rs1256031 and rs4986938) in patients with POAG and the control subjects for each gender are shown in Table 2 . ESR2 genotype and allele frequencies were in Hardy-Weinberg equilibrium in patients with NTG and HTG and the control subjects for each gender. There were significant differences in genotype frequencies of rs1256031 and rs4986938 between the HTG patients and the control subjects in women ( P = .033 and P = .043 respectively, χ 2 test). The frequencies of the C allele of rs1256031 and the G allele of rs4986938 were significantly higher in patients with HTG in comparison to the control subjects in women (rs1256031: 53.6% vs 43.4%, P = .044; rs4986938: 89.2% vs 80.6%, P = .027, Fisher exact test). Adjusted for age, an almost 2-fold increased risk of HTG was found with the C allele of rs1256031 ( P = .011, odds ratio 2.38, 95% confidence interval 1.21–4.68) and the G allele of rs4986938 ( P = .029, odds ratio 1.89, 95% confidence interval 1.06-3.38) in women. When the demographic and clinical features in patients with POAG were compared between ESR2 genotypes for each gender, a significant difference in the maximum IOP was noted between the rs1256031 genotypes in women ( P = .039, ANOVA, Figure ). The maximum IOPs in female POAG patients with the CC or TC genotypes were significantly higher than that in female POAG patients with the TT genotype ( P = .018 and P = .026, respectively, Figure ).
| Men | Women | |||||
|---|---|---|---|---|---|---|
| Control (n = 70) | POAG | Control (n = 121) | POAG | |||
| NTG (n = 91) | HTG (n = 129) | NTG (n = 122) | HTG (n = 83) | |||
| Age at blood sampling (years) | 64.5 ± 12.6 | 62.6 ± 13.6 | 61.3 ± 15.6 | 66.4 ± 10.7 | 64.9 ± 13.7 | 65.4 ± 13.2 |
| Age at diagnosis (years) | — | 56.8 ± 13.8 | 53.0 ± 16.1 | — | 57.8 ± 13.0 | 56.5 ± 13.8 |
| Maximum IOP (mm Hg) | 15.1 ± 2.7 | 18.6 ± 1.9 | 29.3 ± 9.1 | 14.9 ± 2.8 | 18.5 ± 1.9 | 27.3 ± 8.7 |
| Men | Women | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Control (n = 70) n (%) | NTG (n = 91) n (%) | P Value | HTG (n = 129) n (%) | P Value | Control (n = 121) n (%) | NTG (n = 122) n (%) | P Value | HTG (n = 83) n (%) | P Value | |
| rs1256031 | ||||||||||
| Genotype | ||||||||||
| CC | 23 (32.9) | 28 (30.8) | 32 (24.8) | 26 (21.5) | 31 (25.4) | 21 (25.3) | ||||
| TC | 31 (44.3) | 48 (52.7) | .48 a | 66 (51.2) | .47 a | 53 (43.8) | 59 (48.4) | .35 a | 47 (56.6) | .033 a |
| TT | 16 (22.8) | 15 (16.5) | 31 (24.0) | 42 (34.7) | 32 (26.2) | 15 (18.1) | ||||
| Allele | ||||||||||
| C | 77 (55.0) | 104 (57.1) | 130 (50.4) | 105 (43.4) | 121 (49.6) | 89 (53.6) | ||||
| T | 63 (45.0) | 78 (42.9) | .73 b | 128 (49.6) | .40 b | 137 (56.6) | 123 (50.4) | .17 b | 77 (46.4) | .044 b |
| rs4986938 | ||||||||||
| Genotype | ||||||||||
| AA | 0 (0) | 2 (2.2) | 5 (3.9) | 7 (5.8) | 1 (0.8) | 0 (0) | ||||
| GA | 15 (21.4) | 19 (20.9) | .46 a | 22 (17.0) | .20 a | 33 (27.3) | 30 (24.6) | .074 a | 18 (21.7) | .043 a |
| GG | 55 (78.6) | 70 (76.9) | 102 (79.1) | 81 (66.9) | 91 (74.6) | 65 (78.3) | ||||
| Allele | ||||||||||
| A | 15 (10.7) | 23 (12.6) | 32 (12.4) | 47 (19.4) | 32 (13.1) | 18 (10.8) | ||||
| G | 125 (89.3) | 159 (87.4) | .73 b | 226 (87.6) | .75 b | 195 (80.6) | 212 (86.9) | .066 b | 148 (89.2) | .027 b |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
