Modeling of Lowe Patient-Derived Induced Pluripotent Stem Cells Into Trabecular Meshwork

HIGHLIGHTS

  • •

    Characterization of Lowe syndrome iHTM cell lines.

  • •

    OCRL deficiency caused defects in phagocytosis, primary ciliogenesis, and lysosome positioning.

  • •

    iHTM cells as in vitro models for future mechanistic and therapeutic studies for glaucoma.

Purpose

Congenital glaucoma is the leading cause of vision loss in patients with Lowe syndrome (LS), a rare X-linked disease caused by mutations in the OCRL gene. OCRL encodes an inositol polyphosphate 5-phosphatase. Despite significant research efforts, the pathogenesis of glaucoma caused by OCRL deficiency remains unclear, partly due to the inaccessibility of patient-derived ocular cells.

Design

The study design is a comparative cell-based study focused on the functional characterization of induced human trabecular meshwork (iHTM) cell lines.

Methods

Two induced LS pluripotent stem cell (iPSC) lines, previously isolated and generated from an LS patient family, were differentiated into trabecular meshwork cells. LS100 is an affected LS patient; LS200 is an unaffected healthy sibling. Patient-based trabecular meshwork (iHTM) cell models were generated. Both stem cell and trabecular meshwork markers were evaluated by both immunoblot as well as immunostaining analysis.

Results

Induced trabecular meshwork cells expressed TM cell markers such as collagen IV, accompanied by the loss of pluripotency markers like OCT4. TM-like responses upon dexamethasone challenge included increased cross-linked actin network formation. The phagocytic function of TM cells was demonstrated by fluorescent labeling phagocytosis assay. Immunostaining revealed that compared to LS200-iHTM, LS100-iHTM had shortened primary cilia. This defect was further supported by reduced Gli1 protein expression in LS100-iHTM. Immunostaining of LAMP1, a lysosome marker, showed greater perinuclear lysosome clustering in LS100-iHTM than LS200-iHTM, indicating potentially dysfunctional nutrient sensing in the patient-derived iHTM cells.

Conclusions

We established two iHTM cell lines derived from iPSCs of an LS patient and his healthy sibling. Functional characterization of both cell lines showed that OCRL deficiency in LS altered downstream pathways related to phagocytosis, primary ciliogenesis, and lysosome positioning. iHTM cells function like TM cells and retain LS-associated defects, highlighting their potential as in vitro models for future mechanistic and therapeutic studies.

INTRODUCTION

O culocerebrorenal syndrome of Lowe (LS, OMIM # 300535 ) is a rare, multisystem X-linked disorder characterized by congenital cataracts, glaucoma, proximal renal tubule defects, and developmental and intellectual delays. Hypotonia, epilepsy, and dental anomalies are also commonly described in LS patients. , Genetic and molecular analyses have revealed that LS is caused by mutations in the OCRL gene on chromosome Xq26, leading to a malformed phosphatidylinositol 4,5-bisphosphate-5-phosphatase (OCRL-1). The OCRL-1 protein is an inositol polyphosphate 5-phosphatase, mainly recognized to metabolize phosphatidylinositol 4,5-bisphosphate (PIP2), an essential component of the plasma membrane. ,,, In vitro cell models of OCRL showed its function in regulating lysosome positioning, cytoskeletal reorganization, and primary ciliogenesis. ,

Congenital glaucoma was found to occur in 55% of LS patients. , Severe glaucoma in these patients often leads to vision loss at an early age. Despite the urgent need to understand the pathogenesis underlying LS-induced glaucoma, research efforts have been hindered by the lack of well-established in vitro and in vivo models. Recently, induced pluripotent stem cell (iPSC) lines from LS patients and their healthy siblings were made available by Liu et al. Among these iPSC cell lines are LS100 from a patient and LS200 from his normally developing brother. LS100-patient was confirmed to have a loss of intron 23/exon 24 splice with a cryptic splice site in exon 24, a common mutant genotype of LS-associated OCRL mutation. Compared to LS200-control, neural progenitor cells derived from LS100-patient were found to have differentially expressed genes highly relevant to glaucoma such as EFEMP1 and SPON1. These findings suggest that Lowe patient derived cells can be used to study eye manifestations in LS.

The aim of the present study was to establish a trabecular meshwork (TM) cell line that can model the pathogenesis of glaucoma secondary to OCRL mutation. Specifically, we successfully differentiated LS100-patient and LS200-control into induced human trabecular meshwork (iHTM) cells. The iHTM cells expressed prototypical TM proteins and did not retain pluripotency. Compared to those from control cells, LS100-derived iHTM cells exhibited defective functions of TM cells, including myocilin production in response to glucocorticoid exposure, irregular ciliogenesis, and increased perinuclear lysosome positioning.

MATERIAL AND METHODS

REAGENTS

Anti-OCRL mouse antibody (N166A/26) for immunofluorescence was purchased from UC Davis/NIH NeuroMab Facility (Davis, CA). Generation and characterization of anti-OCRL antibodies for western blot have been described by Ungewickell et al ; anti-OCRL antibody was affinity purified with beads coated with N-terminal peptide (generous gift of Dr Phil Majerus, Washington University, St Louis, MO, USA). Anti–γ-tubulin (Poly6209) was obtained from BioLegend (San Diego, CA). All secondary antibodies for immunostaining were purchased from Life Technologies (Carlsbad, CA). ProLong gold antifade mount with or without DAPI was purchased from Invitrogen. Antibodies against OCT4, TRA160 were gifts from Dr Jeffery Goldberg’s lab (Stanford); Arl13b, Gli1, a-actin, and LAMP1 were purchased from ProteinTech.

CELL CULTURE

The iPSC cell lines, LS100 and LS200, were obtained from Dr Herbert Lachman’s lab (Albert Einstein University). LS100 iPSCs were generated from a patient with Lowe syndrome, and LS200 iPSCs were generated from the patient’s healthy brother. To identify mutations in the patient, DNA was originally sequenced at each OCRL and intron-exon junction by GeneDx. We performed sanger sequencing to confirm the mutation in our lab using primers listed below:

F-SL100:ATTGTGTTGGCCATGAGGAG;

R-SL100: GGAGGCCTCAGGAGAAGACT

The patient’s iPSCs were cultured in mTeSR1 (catalog #85850; StemCell Technologies) on Matrigel coated plates (catalog #354671; Corning). Human trabecular meshwork cells were obtained from cadaveric corneas (Indiana Lions Eye Bank) with university institutional review board (IRB 34652) approval; characterization and culturing protocols were based upon established methods.

DIFFERENTIATION OF IPSC INTO IHTM

Protocols for generating iHTM cells were based on those by Zhu et al. In brief, iPSC colonies were gently lifted from the feeder layer with a detachment solution (DMEM, 1 mM CaCl 2 , 2 mg/mL Collagenase IV, 0.125% trypsin) at 37 °C. The colonies were transferred to 0.1% gelatin-coated plates and incubated for 1 hour at 37 °C with 5% CO₂ in iPSC medium to remove MEF cells. The colonies were pelleted in microcentrifuge tubes (300xg for 5 minutes), washed with PBS, incubated with Accutase, and dissociated into single cells. Human trabecular meshwork (TM) cells were cultured in MEM-α medium supplemented with 10% inactivated FBS and 0.2% primocin. The conditioned media from these primary TM cells was collected daily, pooled, and sterilized by filtration through 0.2-µm pore size MCE membrane filters (Millipore). Once iPSCs reached 5% confluency, the sterilized conditioned media was used to induce differentiation, with daily media changes.

IMMUNOFLUORESCENCE

Cells were grown on 8-well chamber slides and fixed in 4% PFA for 10 minutes at room temperature. Cells were permeabilized with 0.5% Triton X-100 and incubated with primary antibodies diluted in blocking solution (0.5% BSA, 10% normal goat serum in PBS) for 1 hour at room temperature. After washing with PBS, cells were incubated with fluorophore conjugated secondary antibodies diluted in blocking buffer for 1 hour at room temperature. Nuclei were counterstained with DAPI (Invitrogen), and slides were observed by a Zeiss LSM850 microscope.

WESTERN BLOTTING

Cell lysates in protein loading buffer were separated on 10% gels at 90 V constant current in SDS/PAGE running buffer (100 mM Tris base, 100 mM Hepes, 0.1% SDS) and transferred onto PVDF membrane in transfer buffer (48 mM Tris, 1 mM SDS, 400 mM glycine,10% methanol) at 80 V for 2 h. Blots were blocked for 1hour at room temperature in PBST-milk (137 mM NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 0.1% Tween-20, pH = 7.4, 5% non-fat dried milk) and incubated with the appropriately diluted primary antibodies overnight at 4 °C or for 1 hour at room temperature. After incubation with a secondary antibody conjugated with horseradish peroxidase for 1 hour at room temperature and washing, specific bands were detected by chemiluminescence using SuperSignal West Femto (Pierce) as a substrate and visualized.

IDENTIFICATION AND QUANTIFICATION OF CLANs POSITIVE CELLS

Cells were imaged and counted according to the method described by Filla et al. Cells were stained fixed with 4% PFA, permeabilized with 0.5% Triton X-100, and incubated with A488-phalloidin (catalog #A12379, Molecular Probes) diluted in blocking solution (0.5% BSA, 10% normal goat serum in PBS) for 1 hour at room temperature. Cells were washed with PBS, incubated with DAPI, and imaged using a 20x objective. CLANs were identified as three bright spokes of actin filaments that connected at a point. More than 40 cells were analyzed per sample; two-tailed t-test was performed for statistical analysis.

pHrodo-GREEN PHAGOCYTOSIS ASSAY

iHTM cells were incubated with pHrodo-Green particles (Invitrogen, CA) or with media alone for 15 minutes at 37 °C, following the manufacturer’s instructions. Subsequently, the cells were placed on ice to halt the phagocytosis reaction. Green fluorescence was immediately measured using a Zeiss LSM 850 confocal microscope.

CILIOGENESIS ASSAY

iHTM cells were seeded onto coverslips at 60% confluency in 15% FBS containing medium for 12 hours followed by 24-hour serum-starvation. The cells were fixed in 4% formaldehyde for 10 minutes at room temperature, followed by IF staining with anti–Arl13b and antigamma tubulin antibodies. Level of ciliogenesis is defined by the percentage of cells that have an Arl13b-marked axoneme emerging from gamma-tubulin-positive basal bodies. More than 150 cells were analyzed per sample; two-tailed t-test was performed for statistical analysis.

QUANTIFICATION OF LYSOSOME DISTRIBUTION

Average LAMP1 or mTOR intensities were measured for the whole cell (A total ) and the area within 10 um of the nucleus (B perinuclear); the perinuclear index was defined as B perinuclear / A total .

RESULTS

  • 1.

    Lowe syndrome patient and congenital glaucoma : A pediatric case of congenital cataracts with early-onset glaucoma is described. Cataract extraction was performed at 5 and 7 weeks of age, and by approximately 12 months of age glaucoma developed; oral acetazolamide failed to control IOP. The left eye was more severely affected throughout. The patient underwent several trabeculectomies, which were unsuccessful, with a postoperative hyphema occurring in the left eye after one procedure. Around age 2 years, bilateral glaucoma drainage implants (tube shunts) were placed and IOPs subsequently remained under 20 mmHg for the majority of follow-up. At age 7, the left eye required a second tube implant, which has remained fairly successful. Current visual acuity is good in the right eye (approximately 20/40 with correction), whereas the left eye has severely limited vision (finger counting); the cornea in the left eye is thicker, potentially affecting the accuracy of IOP readings. The patient is maintained on dorzolamide/timolol ophthalmic solution twice daily in both eyes, latanoprost at night in both eyes, and pilocarpine 4% in the left eye twice daily. The main medical conditions include renal tubular acidosis, hypotonia, and glaucoma. The control cells are derived from his normally developing older brother, 22 years old, with blood as the source for generate iPS cells. The patient diagnosis was confirmed by DNA sequencing showing a G > T transversion at cDNA position 2582 (c.2582-1 G > T).

  • 2.

    Differentiated iPSCs demonstrate the morphology and express marker genes of TM cells: We first examined whether iPSC differentiation based on a previously reported protocol successfully generated cells with TM-like morphology and gene expression. Briefly, conditioned media generated with human TM cells were used to differentiate iPSC into iHTM cells ( Figure 1 A). Conditioned TM medium was generated from primary cultures of TM cells obtained from previous studies. Microscopic examination beginning at 20 days of culturing revealed morphology similar to human eye-cup derived primary TM cells ( Figure 1 B). Successful differentiation was also supported by increased expression of TM markers—collagen IV and myocilin, as well as decreased expression of pluripotency markers—OCT4 ( Figure 1 C,D). Taken together, these results indicate that iPSCs have differentiated into TM-like (iHTM) cells.

    FIGURE 1

    Lowe syndrome (LS) patient iPSC differentiate into trabecular meshwork iHTM cells. A. Schematic of protocol for the differentiation of iPSCs from an LS patient (LS100) and his healthy brother (LS200) into TM-like cells (iHTM). B. Representative images on day 20 showing similar morphology among primary human trabecular meshwork (HTM) cells and those from LS100-patient and LS200-control (scale bar 40 um). C. Representative immunofluorescence images of iPSC and HTM markers in LS100-patient and LS200-control at day 20, collagen IV (green) and Oct4 (red), DAPI (blue), scale bar (20 um). D. Representative immunofluorescence images of iPSC and HTM markers in LS100-patient and LS200-control at day 20, myocilin (green) and TRA-1-60 (red), DAPI (blue), scale bar 20 um).

  • 3.

    iHTM cells respond to dexamethasone by forming CLANs: Corticosteroid induced increase in myocilin is a hallmark of primary open angle glaucoma. TM cells respond to glucocorticoids treatment by increasing myocilin production. We next determined whether the iHTM cells display these functional characteristics of TM cells. Western blotting revealed Increased myocilin upon dexamethasone (DEX) challenge in both iHTM cell lines ( Figure 2 A). Another marker of TM cells is increased formation of actin cytoskeletal networks. DEX-exposed TM cells undergo cytoskeletal rearrangements and form distinct geodesic dome-like structures known as cross-linked actin networks (CLANs). This phenomenon was also observed in iHTM cells. Significantly more CLANs formed in DEX-treated iHTM cells than in vehicle control cells treated with DMSO, which demonstrated organized stress fibers ( Figure 2 B). These findings support that both iHTM cell lines respond to glucocorticoid in a TM-like fashion and exhibit TM features that are observed in primary cell culture.

Sep 19, 2026 | Posted by in OPHTHALMOLOGY | Comments Off on Modeling of Lowe Patient-Derived Induced Pluripotent Stem Cells Into Trabecular Meshwork

Full access? Get Clinical Tree

Get Clinical Tree app for offline access