2.1

Construction of multiple shRNA expression plasmids

A recombinant plasmid containing 4 different shRNAs was constructed. Based on the design principles for shRNA constructs, we selected RNAi target sites, each within the open reading frames of human TRF2, RAD51, NBS1 and TERT. The specific base sequences of the target sites of TRF2, RAD51, NBS1 and TERT are as follows:

• 
  

  TRF2 5′-GAACAAGCGCATGACAATA-3′.

  
  
• 
  

  NBS1 5′- AACATACGTAGCTGACACAGA −3′.

  
  
• 
  

  RAD51 5′- GCATCAGCCATGATGGTAG-3′.

  
  
• 
  

  hTERT 5′-GAGCCACGTCTCTACCTTG-3′.

For each target sequence, a pair of sense and anti-sense strands was designed; their respective complementary chains were then synthesized by annealing. The shRNA duplexes thus obtained were subcloned into the pEGFP vector (containing the green fluorescein protein (GFP) gene and kanamycin marker) with the U6 promoter between the HindIII and BamHI restriction sites. In addition, plasmids targeting key proteins of ALT mechanism and telomerase mechanism were also constructed respectively, i.e. , pEGFP-shTRF2-shNBS1-shRAD51 and pEGFP-shTERT. The negative HK sequence 5′-GACTTCATAAGGCGCATGC-3′ was used as a control (it did not target any specific human gene). The plasmids were constructed by Wuhan Genesil Biotechnology Co., Ltd. (Wuhan, China). All the constructs used in this study were verified by DNA sequencing.

2.2

Cell culture and transfection

The human laryngeal squamous carcinoma cell line (HEp-2) was purchased from the China Center for Type Culture Collection (Wuhan, China). The cells were cultured in 6-well plates containing Dulbecco’s Modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (Gibco-BRL, Carlsbad, CA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C and 5% CO ₂ gas phase. The 2 μg plasmid vector and 4 μl transfection reagent Lipofectamine™ 2000 (Invitrogen) were respectively diluted by using 100 μl serum-free 1640, leaving it at room temperature for 20 min. The compound was added to each well and thoroughly mixed. There were five groups divided for the study: group A, cells transfected with pEGFP-shTRF2-shRAD51-shNBS1-shTERT; group B, cells transfected with pEGFP-shTRF2-shNBS1-shRAD51; group C, cells transfected with pEGFP-shTERT; group D, cells transfected with pEGFP-HK; and group E, the normal cultured HEp-2 cells without any treatment. Fluorescence expression was detected after treatment for 24 h by using a fluorescence microscope (TCS SP2 MP; Leica, Germany).

2.3

RNA extraction and real-time reverse transcription polymerase chain reaction

Total RNAs were extracted from the cells of each group by using the Trizol reagent (Invitrogen, San Diego, CA), according to the manufacturer’s instructions. The purity and concentration of the total RNAs were measured by ultraviolet spectrophotometry. The total RNAs were used as the template for reverse transcription polymerase chain reaction (RT-PCR), and this was performed according to the protocol of the reverse transcription reaction kit (TaKaRa, Japan).SYBR Green I PCR was performed in duplicate for each sample using the ABI PRISM 7500 Sequence Detector (Perkin-Elmer Applied Biosystems) and the SYBR ExscriptTM RT-PCR Kit (TaKaRa, Japan). The following primers were used: TRF2: forward primer 5′-CAGTGTCTGTCGCGGATTG-3′ and reverse primer 5′-CCCTGGTGCTGGCTGTTTA-3′; NBS1: forward primer 5′-CAAGGCGTGTCAGTTGATG-3′ and reverse primer 5′-TGAGGGTGTAGCAGGTTGT-3′; RAD51: forward primer 5′-ATACTGTGGAGGCTGTTGC-3′ and reverse primer 5′-TCATGGCTGATGCTTGATA-3′; TERT: forward primer 5′-TATGCCGTGGTCCAGAAGG-3′ and reverse primer 5′-CG TGGGTGAGGTGAGGTGTC-3′. GAPDH was amplified (forward primer, 5′-GAAACCTGCCAAGTATGATG-3′ and reverse primer, 5′-ACCAGGAAATAGGCTTGAGC-3′ ) and used as a standard for each PCR analysis. These primers were designed and synthesized by TaKaRa Biotechnology (Dalian, China). The conditions for the PCR were as follows: 40 cycles of denaturation at 95 °C for 10 s, annealing at 95 °C for 5 s, and extension at 60 °C for 30 s. RT-negative tubes served as the negative control. The standard curves for each mRNA were constructed using serial known dilutions of the standard cDNA. The unknown samples were quantified using the software of the ABI PRISM 7500 sequence detector system, which calculated the Ct value for each sample and then determined the initial amount of the target genes using the standard curve. According to each standard curve, we obtained the respective copy numbers of GAPDH, TRF2, RAD51, NBS1 and TERT. The target gene expression was normalized by using the reference gene GAPDH. The ratio between the copy numbers of the target gene (TRF2, RAD51, NBS1 and TERT) and that of GAPDH represented the relative value of the expression of the target gene for each sample; this value could be compared with the relative values of the target gene expression for other samples. Each experiment was repeated for 3 times.

2.4

Detection of protein expression levels by western blotting

Cells were harvested and washed with cold phosphate-buffered saline solution. The total proteins were then extracted in the extraction buffer from the cells and lysed in Nonidet P-40 isotonic lysis buffer. The proteins were quantitated by the standard Bradford assay. Equal amounts of protein from the treated cells were loaded and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel and then transferred onto nitrocellulose membranes. The blotted membrane was incubated with antibodies against TRF2, RAD51, NBS1, TERT and GAPDH, followed by incubation with a secondary antibody conjugated to horseradish peroxidase. All antibodies were obtained from Santa Cruz Biotech (Santa Cruz, CA). The proteins were detected by using the ECL Test Kit and an enhanced chemiluminescence agent (Pierce Biotech Inc., Rockford, IL) and exposed to an X-ray film. Protein expressions were semiquantitatively analyzed using the Villber Lourmat scanning system (Marne-la-Vallée, France).

2.5

Flow cytometry fluorescent in situ hybridization (flow-FISH)

For analyses of telomere lengths, nuclei were isolated by resuspending 3 × 10 ⁵ cells in 2% Triton X-100⁄0.1 M citric acid buffer, and vortexing, incubating for 10 min at room temperature (RT), and vortexing again. After a single washing step with PBS, samples were directly subjected to denaturation. The hybridization mixture contained 75% formamide, 1% BSA, 20 mM Tris HCl pH 7.l, 20 mM NaCl, and 50 nM FITC-conjugated (CCCTAA) ₃ peptide nucleic acid (PNA) probe (Dako, Carpinteria, CA). After 10 min of denaturation on a thermo block at 80 °C, the samples were allowed to hybridize at RT overnight. Washing steps were performed in PBS by incubation on a heat block at 40 °C for 10 min and then centrifugation for 5 min at 700 rpm for cells. Samples were resuspended in 200 ml DNA staining solution containing 50 ng/ml propidium iodide (PI), 0.1% BSA, and 10 mg/ml RNaseA (DNAse free) in PBS. For DNA counterstaining, cells were resuspended in 500 μl staining solution (PBS, 10 U/ml RNase A, 0.1% BSA, 0.1 lg/ml PI) for 2 h before acquisition on a FACScan (Becton Dickinson, Franklin Lakes, NJ) flow cytometer. Mean telomere fluorescence of cells was analyzed with Cell Quest software (Becton Dickinson).

2.6

Cell viability evaluation by CCK-8

Cell viability assays were performed by cell counting Kit-8 (CCK-8) (WST-8, Dojindo, Kumamoto, Japan), according to the supplier recommendations. Cells were inoculated to 96-well plates at 1 × 10 ³ cells per well and cultured in the medium with different doses of gossypol. At the indicated time points, the cell numbers in three wells were measured as the absorbance (450 nm) of reduced WST-8. The WST-8 reagent solution (10 μl) was added to each well of a 96 well microplate containing 100 μl of cells in the culture medium at various densities, and the plates were incubated for 2 h at 37 °C. Absorbance was measured at 450 nm using auto microplate reader. Cell viability was expressed as the percentage of viable cells relative to untreated cells using the absorbance at 450 nm.

2.7

Mice

Thirty female Balb/c nude mice, aged between five and six weeks (body weight 16–18 g), were purchased from the Experimental Animal Centre of Hubei Province of China. All the mice were housed in cages, under laminar air flow, in pathogen-free conditions. The mice were maintained at a constant temperature (18–22 °C) and relative humidity (50%–80%), with 12-h dark/light cycles. They were fed a standard diet and given water ad libitum . All experiments were performed with aseptic techniques under laminar air flow. The Principles of Laboratory Animal Care (NIH publication no. 85Y23, revised 1996) were followed, and the experimental protocol was approved by the Animal Care Committee, Wuhan University.

2.8

Xenograft assays

HEp-2 cells (5 × 10 ⁶ cells) were suspended in 200 μl serum free DMEM and Matrigel (1:1) and then injected subcutaneously into the upper right flank region of nude mice when the mice grew to 4 weeks old. Tumor size was measured with a caliper rule every 7 days. The tumor volume was estimated with the formula “ a × b ² × 0.5”, in which a represents the longest and b the shortest radius of the tumor in centimeters.

2.9

Statistical analysis

All values are expressed as the mean ± SD. Statistical analyses were carried out by Student’s t-test performed using the SPSS statistical software (version 13.0; SPSS Inc., Chicago, IL). Probability values of p < 0.05 were considered statistically significant.

2.1

Construction of multiple shRNA expression plasmids

A recombinant plasmid containing 4 different shRNAs was constructed. Based on the design principles for shRNA constructs, we selected RNAi target sites, each within the open reading frames of human TRF2, RAD51, NBS1 and TERT. The specific base sequences of the target sites of TRF2, RAD51, NBS1 and TERT are as follows:

• 
  

  TRF2 5′-GAACAAGCGCATGACAATA-3′.

  
  
• 
  

  NBS1 5′- AACATACGTAGCTGACACAGA −3′.

  
  
• 
  

  RAD51 5′- GCATCAGCCATGATGGTAG-3′.

  
  
• 
  

  hTERT 5′-GAGCCACGTCTCTACCTTG-3′.

For each target sequence, a pair of sense and anti-sense strands was designed; their respective complementary chains were then synthesized by annealing. The shRNA duplexes thus obtained were subcloned into the pEGFP vector (containing the green fluorescein protein (GFP) gene and kanamycin marker) with the U6 promoter between the HindIII and BamHI restriction sites. In addition, plasmids targeting key proteins of ALT mechanism and telomerase mechanism were also constructed respectively, i.e. , pEGFP-shTRF2-shNBS1-shRAD51 and pEGFP-shTERT. The negative HK sequence 5′-GACTTCATAAGGCGCATGC-3′ was used as a control (it did not target any specific human gene). The plasmids were constructed by Wuhan Genesil Biotechnology Co., Ltd. (Wuhan, China). All the constructs used in this study were verified by DNA sequencing.

2.2

Cell culture and transfection

The human laryngeal squamous carcinoma cell line (HEp-2) was purchased from the China Center for Type Culture Collection (Wuhan, China). The cells were cultured in 6-well plates containing Dulbecco’s Modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (Gibco-BRL, Carlsbad, CA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C and 5% CO ₂ gas phase. The 2 μg plasmid vector and 4 μl transfection reagent Lipofectamine™ 2000 (Invitrogen) were respectively diluted by using 100 μl serum-free 1640, leaving it at room temperature for 20 min. The compound was added to each well and thoroughly mixed. There were five groups divided for the study: group A, cells transfected with pEGFP-shTRF2-shRAD51-shNBS1-shTERT; group B, cells transfected with pEGFP-shTRF2-shNBS1-shRAD51; group C, cells transfected with pEGFP-shTERT; group D, cells transfected with pEGFP-HK; and group E, the normal cultured HEp-2 cells without any treatment. Fluorescence expression was detected after treatment for 24 h by using a fluorescence microscope (TCS SP2 MP; Leica, Germany).

2.3

RNA extraction and real-time reverse transcription polymerase chain reaction

Total RNAs were extracted from the cells of each group by using the Trizol reagent (Invitrogen, San Diego, CA), according to the manufacturer’s instructions. The purity and concentration of the total RNAs were measured by ultraviolet spectrophotometry. The total RNAs were used as the template for reverse transcription polymerase chain reaction (RT-PCR), and this was performed according to the protocol of the reverse transcription reaction kit (TaKaRa, Japan).SYBR Green I PCR was performed in duplicate for each sample using the ABI PRISM 7500 Sequence Detector (Perkin-Elmer Applied Biosystems) and the SYBR ExscriptTM RT-PCR Kit (TaKaRa, Japan). The following primers were used: TRF2: forward primer 5′-CAGTGTCTGTCGCGGATTG-3′ and reverse primer 5′-CCCTGGTGCTGGCTGTTTA-3′; NBS1: forward primer 5′-CAAGGCGTGTCAGTTGATG-3′ and reverse primer 5′-TGAGGGTGTAGCAGGTTGT-3′; RAD51: forward primer 5′-ATACTGTGGAGGCTGTTGC-3′ and reverse primer 5′-TCATGGCTGATGCTTGATA-3′; TERT: forward primer 5′-TATGCCGTGGTCCAGAAGG-3′ and reverse primer 5′-CG TGGGTGAGGTGAGGTGTC-3′. GAPDH was amplified (forward primer, 5′-GAAACCTGCCAAGTATGATG-3′ and reverse primer, 5′-ACCAGGAAATAGGCTTGAGC-3′ ) and used as a standard for each PCR analysis. These primers were designed and synthesized by TaKaRa Biotechnology (Dalian, China). The conditions for the PCR were as follows: 40 cycles of denaturation at 95 °C for 10 s, annealing at 95 °C for 5 s, and extension at 60 °C for 30 s. RT-negative tubes served as the negative control. The standard curves for each mRNA were constructed using serial known dilutions of the standard cDNA. The unknown samples were quantified using the software of the ABI PRISM 7500 sequence detector system, which calculated the Ct value for each sample and then determined the initial amount of the target genes using the standard curve. According to each standard curve, we obtained the respective copy numbers of GAPDH, TRF2, RAD51, NBS1 and TERT. The target gene expression was normalized by using the reference gene GAPDH. The ratio between the copy numbers of the target gene (TRF2, RAD51, NBS1 and TERT) and that of GAPDH represented the relative value of the expression of the target gene for each sample; this value could be compared with the relative values of the target gene expression for other samples. Each experiment was repeated for 3 times.

2.4

Detection of protein expression levels by western blotting

Cells were harvested and washed with cold phosphate-buffered saline solution. The total proteins were then extracted in the extraction buffer from the cells and lysed in Nonidet P-40 isotonic lysis buffer. The proteins were quantitated by the standard Bradford assay. Equal amounts of protein from the treated cells were loaded and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel and then transferred onto nitrocellulose membranes. The blotted membrane was incubated with antibodies against TRF2, RAD51, NBS1, TERT and GAPDH, followed by incubation with a secondary antibody conjugated to horseradish peroxidase. All antibodies were obtained from Santa Cruz Biotech (Santa Cruz, CA). The proteins were detected by using the ECL Test Kit and an enhanced chemiluminescence agent (Pierce Biotech Inc., Rockford, IL) and exposed to an X-ray film. Protein expressions were semiquantitatively analyzed using the Villber Lourmat scanning system (Marne-la-Vallée, France).

2.5

Flow cytometry fluorescent in situ hybridization (flow-FISH)

For analyses of telomere lengths, nuclei were isolated by resuspending 3 × 10 ⁵ cells in 2% Triton X-100⁄0.1 M citric acid buffer, and vortexing, incubating for 10 min at room temperature (RT), and vortexing again. After a single washing step with PBS, samples were directly subjected to denaturation. The hybridization mixture contained 75% formamide, 1% BSA, 20 mM Tris HCl pH 7.l, 20 mM NaCl, and 50 nM FITC-conjugated (CCCTAA) ₃ peptide nucleic acid (PNA) probe (Dako, Carpinteria, CA). After 10 min of denaturation on a thermo block at 80 °C, the samples were allowed to hybridize at RT overnight. Washing steps were performed in PBS by incubation on a heat block at 40 °C for 10 min and then centrifugation for 5 min at 700 rpm for cells. Samples were resuspended in 200 ml DNA staining solution containing 50 ng/ml propidium iodide (PI), 0.1% BSA, and 10 mg/ml RNaseA (DNAse free) in PBS. For DNA counterstaining, cells were resuspended in 500 μl staining solution (PBS, 10 U/ml RNase A, 0.1% BSA, 0.1 lg/ml PI) for 2 h before acquisition on a FACScan (Becton Dickinson, Franklin Lakes, NJ) flow cytometer. Mean telomere fluorescence of cells was analyzed with Cell Quest software (Becton Dickinson).

2.6

Cell viability evaluation by CCK-8

Cell viability assays were performed by cell counting Kit-8 (CCK-8) (WST-8, Dojindo, Kumamoto, Japan), according to the supplier recommendations. Cells were inoculated to 96-well plates at 1 × 10 ³ cells per well and cultured in the medium with different doses of gossypol. At the indicated time points, the cell numbers in three wells were measured as the absorbance (450 nm) of reduced WST-8. The WST-8 reagent solution (10 μl) was added to each well of a 96 well microplate containing 100 μl of cells in the culture medium at various densities, and the plates were incubated for 2 h at 37 °C. Absorbance was measured at 450 nm using auto microplate reader. Cell viability was expressed as the percentage of viable cells relative to untreated cells using the absorbance at 450 nm.

2.7

Mice

Thirty female Balb/c nude mice, aged between five and six weeks (body weight 16–18 g), were purchased from the Experimental Animal Centre of Hubei Province of China. All the mice were housed in cages, under laminar air flow, in pathogen-free conditions. The mice were maintained at a constant temperature (18–22 °C) and relative humidity (50%–80%), with 12-h dark/light cycles. They were fed a standard diet and given water ad libitum . All experiments were performed with aseptic techniques under laminar air flow. The Principles of Laboratory Animal Care (NIH publication no. 85Y23, revised 1996) were followed, and the experimental protocol was approved by the Animal Care Committee, Wuhan University.

2.8

Xenograft assays

HEp-2 cells (5 × 10 ⁶ cells) were suspended in 200 μl serum free DMEM and Matrigel (1:1) and then injected subcutaneously into the upper right flank region of nude mice when the mice grew to 4 weeks old. Tumor size was measured with a caliper rule every 7 days. The tumor volume was estimated with the formula “ a × b ² × 0.5”, in which a represents the longest and b the shortest radius of the tumor in centimeters.

2.9

Statistical analysis

All values are expressed as the mean ± SD. Statistical analyses were carried out by Student’s t-test performed using the SPSS statistical software (version 13.0; SPSS Inc., Chicago, IL). Probability values of p < 0.05 were considered statistically significant.