Abstract
Purpose
To investigate the effect of nimesulide on the growth of human laryngeal squamous cell carcinoma.
Materials and methods
The effect of NIM on Hep-2 cell proliferation was measured by the MTT assay. Flow cytometry was used to evaluate the cell cycle and apoptosis in Hep-2 cells. A Western blot analysis was used to detect changes in the protein expression levels of COX-2, Survivin and proliferating cell nuclear antigen (PCNA) in Hep-2 cells. A Hep-2 tumor xenograft model was established in nude mice to observe tumor growth. The changes in the xenograft tumors were observed after hematoxylin/eosin staining. The expression levels of COX-2, Survivin and PCNA proteins and mRNA were measured by immunohistochemical analysis and RT-PCR, respectively.
Results
NIM had time- and dose-dependent inhibitory effect on the proliferation of Hep-2 cells. NIM could prevent the progression of the cell cycle. After NIM treatment, COX-2, Survivin and PCNA protein levels were reduced in the Hep-2 cells. The volume and weight of the xenograft tumors in the NIM treatment group were significantly reduced. The NIM treatment group also exhibited significantly reduced expression levels of COX-2, Survivin and PCNA at both the protein and mRNA levels.
Conclusions
Our results suggested that NIM has significant inhibitory effects on the growth of Hep-2 cells and xenograft tumors in nude mice. Selective COX-2 inhibitors could potentially become part of a comprehensive treatment for laryngeal squamous cell carcinoma. Additional research and development will provide new and broader prospects for the prevention and treatment of laryngeal squamous cell carcinoma.
1
Introduction
Recent studies have demonstrated that non-steroidal anti-inflammatory drugs (NSAIDs) can prevent and treat various tumors. Selective cyclooxygenase-2 (COX-2) inhibitors exhibit high preferential inhibition of COX-2 and only minor effects on cyclooxygenase-1(COX-1). With their lower side effects and high specificity, selective COX-2 inhibitors have become a focus for cancer prevention and treatment, gradually replacing traditional NSAIDs in clinical applications . Nimesulide (NIM), which only weakly inhibits the protective COX-1, was a highly specific COX-2 selective inhibitor. Because the ratio of its IC50 values for COX-2 and COX-1 is 139, NIM can exert effective anti-inflammatory effects with fewer side effects, such as peptic ulcers, gastrointestinal bleeding and renal prostaglandin inhibition, than other NSAIDs (e.g., aspirin, indomethacin, naproxen, piroxicam, and ibuprofen) . In vivo and in vitro experiments demonstrated that NIM could inhibit the growth of colon, pancreatic, breast and lung cancers and multiple other tumors. NIM is frequently used in cancer prevention and treatment studies . Selective COX-2 inhibitors have been increasingly applied to head and neck cancers that have high expression levels of COX-2. However, there have been no reports on the application and the mechanism of action of NIM in the treatment of laryngeal squamous cell carcinoma.
COX-2 is strongly implicated in tumorigenesis. Its functions include stimulating tumor cell proliferation, inhibiting apoptosis, promoting tumor angiogenesis, enhancing tumor cell invasion, decreasing tumor-mediated immune suppression, inducing DNA damage and promoting carcinogenesis . Recent studies have indicated that COX-2 expression is significantly increased in head and neck tumor tissues , and COX-2 over-expression can lead to unrestricted cell proliferation by affecting the expression levels of certain genes involved in cell proliferation and apoptosis, thus promoting the development of head and neck tumors . Survivin is a member of the apoptosis inhibitor proteins and is normally expressed only in embryonic tissues and not in most terminally differentiated adult tissues. However, Survivin is selectively expressed in most tumor tissues, and overexpression is involved in the prognosis of certain tumors . It can inhibit cytochrome C or caspase-8-induced caspase activation and can also prevent spontaneous activation of caspase-3 and caspase-7. Survivin prevents apoptosis via its regulation of the cell cycle at the G2/M phase . In normal proliferating cells and transformed cells, proliferating cell nuclear antigen(PCNA) levels display a clear cyclical pattern. The levels of PCNA begin to increase in the DNA synthesis phase, reach their peak in the G1 and S phases of the cell cycle, begin to decline in the G2 and M phases, and reach their lowest levels in the G0 phase. The changes in the expression levels of PCNA are correlated with the DNA synthesis process. Due to this pattern of expression and its important function in cell proliferation, PCNA can be used as an indicator to evaluate cell proliferation and cell proliferation kinetics .
In this study, we investigated the effects of NIM on laryngeal squamous cell carcinoma Hep-2 cells by examining in vitro cell growth, cell cycle phase distribution, the growth of Hep-2 tumor xenografts in nude mice and the protein and mRNA expression levels of COX-2, Survivin and PCNA in tumors. This study was designed to explore the anti-tumor mechanisms of NIM and provide experimental evidence for the application of NIM in the prevention and treatment of laryngeal squamous cell carcinoma.
2
Materials and methods
2.1
Cell culture
The frozen Hep-2 cells (a human laryngeal squamous cell line from the Center for Biotherapy of Cancer of the National Key Laboratory of Biotherapy in the West China Hospital at Sichuan University) were recovered and seeded in 25 cm 2 tissue culture flasks. After adding RPMI 1640 tissue culture medium, the cells were placed in a CO 2 incubator at 37 °C and allowed to grow for 3–4 days. The cells were passaged after growing to confluence. Trypsin (0.25%) was added to digest the cell attachments for 1–2 min at room temperature. Once most of the cells were detached, as confirmed by inverted microscopy, the trypsin solution was removed. The culture medium was added, and the cell suspension was repeatedly pipetted to mix. After counting, the cell concentration was adjusted to 5 × 10 8 cells/l before seeding them in new tissue culture flasks. The cell growth was observed daily.
2.2
Cell proliferation assay
Hep-2 cells in the logarithmic growth phase were digested with 0.25% trypsin and re-suspended to a single-cell suspension with RPMI 1640 cell culture medium. After adjusting the concentration of the cell suspension to 10 5 cells/ml, the cells were plated in 96-well culture plates at a density of 200 μl/well and then cultured in a CO 2 incubator for 24 h. The tissue culture plates were removed the next day, and various concentrations of NIM (50 μM, 100 μM and 200 μM) (Sigma-Aldrich, St. Louis, MO) dissolved in culture medium at a final concentration of 0.1% DMSO were added to the cells for subsequent analyses. For each concentration, the experiment was performed in triplicate. In addition, a control group was treated with PBS alone, DMSO was as the solvent control. The cells were subsequently cultured for an additional 24, 48, 72 and 96 h. The plates were then removed, and 5 μl of 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (5 mg/ml) solution was added to each well. The culture supernatant was discarded after 4 h of incubation in the dark at 37 °C. The OD 492 value of each well was measured by a microplate reader. The rate of inhibition was calculated as (1 − [OD 492 value of the experimental drug group]/[OD 492 value of the blank control group]) × 100%.
2.3
Flow cytometry (FCM)
The cells were treated with different concentrations of NIM (50 μM, 100 μM or 200 μM) and cultured for 48 h. The control group was treated with only culture medium. The single-cell suspensions were prepared by spinning down the cells at 800–1000 rpm for 5 min, discarding the supernatants, washing twice with PBS and then re-suspending the cell pellets in PBS. The cells were fixed with cold 70% ethanol overnight at 4 °C, washed with PBS two times, stained with propidium iodide (PI) staining solution for 30 min at 4 °C and then filtered through a 400 μm mesh sieve. The cells were then collected, and the cellular DNA content in each phase of the cell cycle was measured by FCM in accordance with the instructions from the apoptosis detection kit. A DNA content histogram was generated, the proportion of cells in each phase was automatically simulated and the rate of apoptosis was calculated. For each concentration of NIM, the experiment was performed in triplicate.
2.4
Measurement of COX-2, Survivin and PCNA by western blotting analysis
Hep-2 cells in the logarithmic growth phase were seeded in 6-well tissue culture plates at a density of 1 × 10 4 cells/well and cultured for 24 h. The cells were subsequently treated with 50 μM, 100 μM or 200 μM NIM, whereas the control group was treated with PBS. The culture medium was discarded after 48 h of incubation. The cells were washed with pre-chilled PBS twice and lysed with RIPA cell lysis buffer. The lysates were incubated on ice for 30 min, and the supernatant was collected after centrifuging at 10,000 rpm for 10 min at 4 °C. The supernatants were quantified using a Coomassie brilliant blue kit, and the aliquots were stored at − 70 °C. The total cellular protein (10 μg) was separated by a 12% (COX-2, PCNA) or a 15% (Survivin) denatured protein SDS-PAGE and then transferred to a PVDF membrane. After blocking the membrane in 5% skim milk for 2 h at 37 °C, the primary antibodies for a sheep anti-human COX-2 polyclonal antibody (Santa Cruz), a rabbit anti-human Survivin polyclonal antibody (Santa Cruz) and a rabbit anti-human PCNA polyclonal antibody (Wuhan Boster Biological Engineering Co) (1:200 dilution) were incubated overnight at 4 °C. The secondary antibodies were incubated for 2 h at 37 °C. After washing the membrane, the ECL substrate was added, and the membrane was exposed to film. The films were processed by developing and fixing.
2.5
Establishment and treatment of Hep-2 xenograft tumors in nude mice
Six- to eight- week-old Balb/c nu/nu nude mice were acquired from the Experimental Animal Center at Sichuan University and housed in specific pathogen-free conditions. Hep-2 cells in the logarithmic growth phase were suspended in PBS at a concentration of 10 8 cells/ml. The cell suspensions (100 μl) were injected subcutaneously into the right sides of the backs of nude mice. When the tumor diameters became greater than 5 mm approximately 2 weeks later, the nude mice were randomly divided into the experimental and the control groups, with six mice in each group. The following procedures were performed. The experimental group (NIM treatment group) was treated with 0.2 ml of NIM injected intraperitoneally at a dosage of 50 mg/kg/2 d for a total of 4 weeks. The control group (saline group) was injected with normal saline intraperitoneally at 0.2 ml/2 d for a total of 4 weeks. The subcutaneous tumor long diameters (a) and short diameters (b) were measured every other day to calculate the tumor volumes (V = a × b 2 /2) for the tumor growth curves. The body weights of the nude mice were also measured once every other day. The mice were sacrificed after 4 weeks to dissect the orthotopic tumors. The tumor and body weights of nude mice were measured and recorded. The tumor inhibition rate was calculated as follows: (tumor weight of the control group − tumor weight of the experimental group)/(tumor weight of the control group) × 100%. The tumor tissue from each nude mouse was divided into two halves. One half was immediately cryopreserved in liquid nitrogen for RNA extraction, while the other half was fixed and paraffin embedded for sectioning and staining according to routine procedures. All animal experiments were performed in accordance with a guideline from the Administration of Animal Experiments for Medical Research Purposes issued by the Ministry of Health of China. The protocol was approved by the Animal Experiment Administration Committee of Sichuan University. All surgery was performed under sodium pentobarbital anesthesia and accomplished in a clean surgery room with sterilized instruments. All efforts were made to minimize the suffering of the mice during the experiments.
2.6
Pathological observations
The tumor tissue was processed with routine hematoxylin/eosin staining. The pathological changes, such as necrosis and changes in cell morphology, in the two xenograft tumor groups were observed and compared by light microscopy.
2.7
Test of COX-2, Survivin and PCNA by immunohistochemistry analysis
A goat anti-human COX-2 polyclonal antibody, a rabbit anti-human Survivin antibody and a rabbit anti-human PCNA polyclonal antibody were the primary antibodies used. PBS replaced the primary antibody in the negative control group. The positive control was the positive biopsy provided in the staining kit. Immunohistochemical staining was performed according to the manufacturer’s instructions. Brown staining in the cytoplasm or nucleus (PCNA was mainly in the nucleus) was classified as positive expression. The slides were examined under double-blind conditions. For each slide, representative areas (10 fields) with clear, positive staining, no nonspecific background color and a characteristic staining intensity were observed under 400 × magnification to detect positive cells.
2.8
Detection of COX-2, Survivin and PCNA by RT-PCR
Portions of excised xenograft tumors from each group were immediately stored in liquid nitrogen for total RNA extraction. A two-step method was used for RT-PCR. The β-actin PCR reaction (upstream primer: TAGAAGCATTTGCGGTGG, downstream primer: GCTACGAGCTGCCTGACG, amplified product of 412 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 30 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 61 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for COX-2 (upstream primer: ACGCTGTCTAGCCAGAGTTT, downstream primer: TATAAGTGCGATTGTACCCG, amplified product of 567 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 35 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 56 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for Survivin (upstream primer: ATTGCTAAGGGGCCCACAGG, downstream primer: CTCAAGGACCACCGCATCTC, amplified product of 368 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 35 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 59 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for PCNA (upstream primer: AGTGTCCCATATCCGCAATT, downstream primer: CTCAAGGACCTCATCAACGA, amplified product of 685 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 30 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 40 s at 52 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The final products (5 μl each) of the reactions were analyzed on 1.0% agarose gels.
2.9
Statistical analysis
The SPSS15.0 statistical analysis software was used for the statistical analysis of the results. All values are shown as the mean ± standard error. The groups were compared using t-tests. The results with α = 0.05 and P < 0.05 were considered statistically significant.
2
Materials and methods
2.1
Cell culture
The frozen Hep-2 cells (a human laryngeal squamous cell line from the Center for Biotherapy of Cancer of the National Key Laboratory of Biotherapy in the West China Hospital at Sichuan University) were recovered and seeded in 25 cm 2 tissue culture flasks. After adding RPMI 1640 tissue culture medium, the cells were placed in a CO 2 incubator at 37 °C and allowed to grow for 3–4 days. The cells were passaged after growing to confluence. Trypsin (0.25%) was added to digest the cell attachments for 1–2 min at room temperature. Once most of the cells were detached, as confirmed by inverted microscopy, the trypsin solution was removed. The culture medium was added, and the cell suspension was repeatedly pipetted to mix. After counting, the cell concentration was adjusted to 5 × 10 8 cells/l before seeding them in new tissue culture flasks. The cell growth was observed daily.
2.2
Cell proliferation assay
Hep-2 cells in the logarithmic growth phase were digested with 0.25% trypsin and re-suspended to a single-cell suspension with RPMI 1640 cell culture medium. After adjusting the concentration of the cell suspension to 10 5 cells/ml, the cells were plated in 96-well culture plates at a density of 200 μl/well and then cultured in a CO 2 incubator for 24 h. The tissue culture plates were removed the next day, and various concentrations of NIM (50 μM, 100 μM and 200 μM) (Sigma-Aldrich, St. Louis, MO) dissolved in culture medium at a final concentration of 0.1% DMSO were added to the cells for subsequent analyses. For each concentration, the experiment was performed in triplicate. In addition, a control group was treated with PBS alone, DMSO was as the solvent control. The cells were subsequently cultured for an additional 24, 48, 72 and 96 h. The plates were then removed, and 5 μl of 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (5 mg/ml) solution was added to each well. The culture supernatant was discarded after 4 h of incubation in the dark at 37 °C. The OD 492 value of each well was measured by a microplate reader. The rate of inhibition was calculated as (1 − [OD 492 value of the experimental drug group]/[OD 492 value of the blank control group]) × 100%.
2.3
Flow cytometry (FCM)
The cells were treated with different concentrations of NIM (50 μM, 100 μM or 200 μM) and cultured for 48 h. The control group was treated with only culture medium. The single-cell suspensions were prepared by spinning down the cells at 800–1000 rpm for 5 min, discarding the supernatants, washing twice with PBS and then re-suspending the cell pellets in PBS. The cells were fixed with cold 70% ethanol overnight at 4 °C, washed with PBS two times, stained with propidium iodide (PI) staining solution for 30 min at 4 °C and then filtered through a 400 μm mesh sieve. The cells were then collected, and the cellular DNA content in each phase of the cell cycle was measured by FCM in accordance with the instructions from the apoptosis detection kit. A DNA content histogram was generated, the proportion of cells in each phase was automatically simulated and the rate of apoptosis was calculated. For each concentration of NIM, the experiment was performed in triplicate.
2.4
Measurement of COX-2, Survivin and PCNA by western blotting analysis
Hep-2 cells in the logarithmic growth phase were seeded in 6-well tissue culture plates at a density of 1 × 10 4 cells/well and cultured for 24 h. The cells were subsequently treated with 50 μM, 100 μM or 200 μM NIM, whereas the control group was treated with PBS. The culture medium was discarded after 48 h of incubation. The cells were washed with pre-chilled PBS twice and lysed with RIPA cell lysis buffer. The lysates were incubated on ice for 30 min, and the supernatant was collected after centrifuging at 10,000 rpm for 10 min at 4 °C. The supernatants were quantified using a Coomassie brilliant blue kit, and the aliquots were stored at − 70 °C. The total cellular protein (10 μg) was separated by a 12% (COX-2, PCNA) or a 15% (Survivin) denatured protein SDS-PAGE and then transferred to a PVDF membrane. After blocking the membrane in 5% skim milk for 2 h at 37 °C, the primary antibodies for a sheep anti-human COX-2 polyclonal antibody (Santa Cruz), a rabbit anti-human Survivin polyclonal antibody (Santa Cruz) and a rabbit anti-human PCNA polyclonal antibody (Wuhan Boster Biological Engineering Co) (1:200 dilution) were incubated overnight at 4 °C. The secondary antibodies were incubated for 2 h at 37 °C. After washing the membrane, the ECL substrate was added, and the membrane was exposed to film. The films were processed by developing and fixing.
2.5
Establishment and treatment of Hep-2 xenograft tumors in nude mice
Six- to eight- week-old Balb/c nu/nu nude mice were acquired from the Experimental Animal Center at Sichuan University and housed in specific pathogen-free conditions. Hep-2 cells in the logarithmic growth phase were suspended in PBS at a concentration of 10 8 cells/ml. The cell suspensions (100 μl) were injected subcutaneously into the right sides of the backs of nude mice. When the tumor diameters became greater than 5 mm approximately 2 weeks later, the nude mice were randomly divided into the experimental and the control groups, with six mice in each group. The following procedures were performed. The experimental group (NIM treatment group) was treated with 0.2 ml of NIM injected intraperitoneally at a dosage of 50 mg/kg/2 d for a total of 4 weeks. The control group (saline group) was injected with normal saline intraperitoneally at 0.2 ml/2 d for a total of 4 weeks. The subcutaneous tumor long diameters (a) and short diameters (b) were measured every other day to calculate the tumor volumes (V = a × b 2 /2) for the tumor growth curves. The body weights of the nude mice were also measured once every other day. The mice were sacrificed after 4 weeks to dissect the orthotopic tumors. The tumor and body weights of nude mice were measured and recorded. The tumor inhibition rate was calculated as follows: (tumor weight of the control group − tumor weight of the experimental group)/(tumor weight of the control group) × 100%. The tumor tissue from each nude mouse was divided into two halves. One half was immediately cryopreserved in liquid nitrogen for RNA extraction, while the other half was fixed and paraffin embedded for sectioning and staining according to routine procedures. All animal experiments were performed in accordance with a guideline from the Administration of Animal Experiments for Medical Research Purposes issued by the Ministry of Health of China. The protocol was approved by the Animal Experiment Administration Committee of Sichuan University. All surgery was performed under sodium pentobarbital anesthesia and accomplished in a clean surgery room with sterilized instruments. All efforts were made to minimize the suffering of the mice during the experiments.
2.6
Pathological observations
The tumor tissue was processed with routine hematoxylin/eosin staining. The pathological changes, such as necrosis and changes in cell morphology, in the two xenograft tumor groups were observed and compared by light microscopy.
2.7
Test of COX-2, Survivin and PCNA by immunohistochemistry analysis
A goat anti-human COX-2 polyclonal antibody, a rabbit anti-human Survivin antibody and a rabbit anti-human PCNA polyclonal antibody were the primary antibodies used. PBS replaced the primary antibody in the negative control group. The positive control was the positive biopsy provided in the staining kit. Immunohistochemical staining was performed according to the manufacturer’s instructions. Brown staining in the cytoplasm or nucleus (PCNA was mainly in the nucleus) was classified as positive expression. The slides were examined under double-blind conditions. For each slide, representative areas (10 fields) with clear, positive staining, no nonspecific background color and a characteristic staining intensity were observed under 400 × magnification to detect positive cells.
2.8
Detection of COX-2, Survivin and PCNA by RT-PCR
Portions of excised xenograft tumors from each group were immediately stored in liquid nitrogen for total RNA extraction. A two-step method was used for RT-PCR. The β-actin PCR reaction (upstream primer: TAGAAGCATTTGCGGTGG, downstream primer: GCTACGAGCTGCCTGACG, amplified product of 412 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 30 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 61 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for COX-2 (upstream primer: ACGCTGTCTAGCCAGAGTTT, downstream primer: TATAAGTGCGATTGTACCCG, amplified product of 567 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 35 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 56 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for Survivin (upstream primer: ATTGCTAAGGGGCCCACAGG, downstream primer: CTCAAGGACCACCGCATCTC, amplified product of 368 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 35 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 30 s at 59 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The reaction for PCNA (upstream primer: AGTGTCCCATATCCGCAATT, downstream primer: CTCAAGGACCTCATCAACGA, amplified product of 685 bp) consisted of the following: an initial denaturation for 4 min at 94 °C; 30 cycles of amplification with denaturation for 30 s at 94 °C, annealing for 40 s at 52 °C, and extension for 30 s at 72 °C; and a final extension for 7 min at 72 °C. The final products (5 μl each) of the reactions were analyzed on 1.0% agarose gels.
2.9
Statistical analysis
The SPSS15.0 statistical analysis software was used for the statistical analysis of the results. All values are shown as the mean ± standard error. The groups were compared using t-tests. The results with α = 0.05 and P < 0.05 were considered statistically significant.
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
