Abstract
Background
Because of the potential role of orexin neuronal circuitry in the regulation of sleep and wakefulness and arousal and breathing, it seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of obstructive sleep apnea/hypopnea syndrome (OSAHS); and it might be a candidate gene in the pathogenesis of OSAHS.
Objective
The present study investigated whether single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
Methods
A total of 394 subjects (217 cases and 177 control subjects) were recruited from China. Diagnostic polysomnography was performed in all patients and control subjects. SNPs in potentially functional regions of the gene were identified; and genotypes, determined by direct sequencing.
Results
By sequencing the promoter, 2 exons, and the exon-intron junctions of the prepro-orexin gene, the g11182C>T SNP was identified. Statistical analysis showed that there were significant differences in the genotype distribution between patients with OSAHS and the control group ( χ 2 2 = 6.437, P = .04). Variant allele T of the g1182C>T polymorphism was more commonly found in patients with OSAHS as compared with control subjects ( χ 2 1 = 5.648, P = .017; odds ratio, 1.449; 95% confidence interval, 1.0466–1.968).
Conclusions
Our results suggest that the prepro-orexin gene polymorphism g1182C>T is associated with susceptibility to OSAHS in Han Chinese. This study provides insights into the genetic information for future studies regarding this gene in OSAHS.
1
Introduction
Obstructive sleep apnea/hypopnea syndrome (OSAHS) is a highly prevalent disorder with multiple comorbidities. Overt sleep apnea has been estimated to affect 2% of middle-aged women and 4% of middle-aged men, at least 1% of preschool children, and at least 11% of the elderly . Its etiology is complex and multifactorial, with evidence that susceptibility is influenced by risk factors that include obesity and obesity-associated traits, craniofacial characteristics associated with reduced upper airway dimensions, as well as ventilatory deficits that predispose to pharyngeal collapsibility during sleep, when neuromuscular output is either reduced or relatively unstable. Although studies of the genetic etiology of the disorder are few, there are growing data that have quantified the heritability of OSAHS, described potential modes of transmission, and have identified suggestive and/or biologically plausible candidate genes .
The excitatory neuropeptide orexin (or hypocretin) is synthesized by neurons restricted to the lateral hypothalamus. Only 2 splice orexin variants (orexin A and orexin B) derived from a unique precursor have been identified, which bind 2 G-protein–coupled receptors (orexin 1 receptor and orexin 2 receptor) . Orexin neuron projections target a large number of forebrain, limbic, and brainstem nuclei ; and, in turn, they receive inputs from numerous brain nuclei that govern interoceptive and homeostatic signals . Orexin signaling is involved in the regulation of many neuronal circuits; the most prominent ones control feeding and energy homeostasis as well as sleep-wake states . Orexin signaling has also been implicated as regulator of autonomous processes such as emotion and cardiorespiratory functions . In rodents, canines, and humans, orexin deficiency is associated with narcolepsy characterized by sleep attacks and sleep fragmentation .
Preliminary data suggest that orexin levels are abnormal in patients with OSAHS. In one study, morning orexin levels were significantly lower in patients with sleep apnea than in controls . In a repeat study examining orexin levels later in the day, this difference persisted . Another study found low orexin levels in patients with obstructive sleep apnea but also found that reduced orexin levels with obstructive sleep apnea did not correlate with body mass index (BMI), treatment with continuous positive airway pressure, or with daytime hypersomnolence . These relationships suggest that orexin levels may not necessarily be a consequence of the syndrome but instead may be involved in the pathogenesis of obstructive sleep apnea.
It seems reasonable to speculate that abnormalities in the prepro-orexin gene could be relevant to studies of OSAHS because of the potential impact of these neuropeptides on arousal and muscle tone, both of which influence the behavior of respiratory systems, and/or because of the close proximity of these neurons to central respiratory control centers, with potential interactions between arousal and respiratory centers. Therefore, the present study investigated whether the single nucleotide polymorphisms (SNPs) in the human prepro-orexin gene are associated with OSAHS in Han Chinese people.
2
Methods
2.1
Patients
The study sample consisted of 217 patients with OSAHS (157 males and 60 females) diagnosed by using the overnight polysomnography (PSG). The patients who met the diagnostic criteria of OSAHS were recruited from the sleep laboratory of the Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, China. No patients were suspected of having narcolepsy, which is an incurable disorder characterized by excessive sleepiness that typically is associated with episodes of cataplexy. In patients with OSAHS, the mean ± SD age was 50.53 ± 8.57 years; apnea/hypopnea index (AHI), 53.9 ± 16.4 events/h; and BMI, 28.32 ± 4.62 kg/m 2 , respectively.
A total of 177 healthy control subjects (113 males and 64 females) were screened for a personal or family history to exclude sleep disorders. The mean ± SD age was 48.91 ± 9.45 years; and BMI, 25.17 ± 3.63 kg/m 2 in the healthy control group. In these subjects, AHI had to be below 5/h as confirmed by PSG.
All subjects were unrelated Chinese Han individuals. Patients with OSAHS and healthy control subjects were screened to exclude definite psychiatric disorders (axis I disorders of the Diagnostic and Statistical Manual of Mental Disorders ) and taking psychotropic medication regularly. General exclusion criteria were drugs influencing the central nervous system; sleep and heart condition; and diseases such as diabetes, acute or ischemic inflammatory liver diseases, thyroid diseases, and acute or chronic renal diseases.
The study was performed in accordance with the Declaration of Helsinki and was approved by the local ethics committee. Written informed consent was given by all participants.
2.2
Polysomnography
All patients with OSAHS and control subjects underwent overnight PSG. PSG consisted of a continuous polygraphic recording electroencephalography (C3/A2, C4/A1), electrooculogram, submental electromyography, right and left anterior tibialis surface electromyography, electrocardiogram, nasal and oral airflow, thoracic and abdominal movements, and oxyhemoglobin saturation. A tracheal microphone was used to detect snoring, and sensors were used to detect the position during sleep. PSG records were interpreted manually according to standard criteria. Apnea episodes were defined as complete cessation of airflow lasting at least 10 seconds. Hypopnea was defined as at least a 50% reduction in airflow for at least 10 seconds accompanied by a reduction in S o 2 of at least 4%. AHI was defined as the number of events of apnea or hypopnea per hour during sleep time, based on the results of the overnight PSG.
2.3
Prepro-orexin gene screening
The molecular analysis of the prepro-orexin gene was performed using genomic DNA obtained from the peripheral blood by conventional methods. Mutations in the promoter, 2 exons, and exon-intron junctions of prepro-orexin gene were screened by direct sequencing (GenBank accession no. AF118885). The detailed list of primers can be found in Table 1 .
| Coding region | Forward primer | Reverse primer |
|---|---|---|
| 5′UTR | 5′TAGTGGAAAGGGCAGAAG 3′ | 5′ATTGTGACCCACTCCCAGG 3′ |
| Exon 1 | 5′ATCTTAGACTTGCCTTTGTCT 3′ | 5′CAAACACAGGCTCTTAGC 3′ |
| Exon 2 | 5′GGCGCAAAGCAAGGAGAACT3′ | 5′GAGTTCCCAGTGCAAGGCCC3′ |
Polymerase chain reaction (PCR) was carried out in a reaction buffer in a total volume of 25 μ L, containing 50 ng of genomic DNA, 1 μ L deoxyribonucleotide triphosphate, 1 μ L proTaq DNA polymerase (Promega Corp, WI), and 0.5 μ L of each primer. The PCR was performed for 35 cycles of 94°C for 30 seconds, 60°C for 60 seconds, and 72°C for 45 seconds, with initial denaturation at 94°C for 5 minutes and a final extension at 72°C for 3 minutes (GeneAmp PCR System 9700; PE Applied Biosystems, CA). The PCR products were purified; then, sequencing was performed on an Applied Biosystems model 3730 automated sequencer (Applied Biosystems Corp, CA). Sequence data were compared with the published sequence of GenBank accession no. AF118885.
2.4
Statistical analysis
Descriptive characteristics of group variables are expressed as mean ± SD. The significance of variables between groups was tested by unpaired Student t test. Comparison of genotype and allele frequencies between the groups was subsequently carried out using Pearson χ 2 test. In addition, the Cochran-Mantel-Haenszel χ 2 statistic was used to test for the association of genotype with OSAHS after adjusting for the BMI. All tests were 2-tailed, and significance level was set at P < .05. The statistical analyses were performed using the program Statistical Package for the Social Sciences 16 (SPSS, Inc, Chicago, IL).
2
Methods
2.1
Patients
The study sample consisted of 217 patients with OSAHS (157 males and 60 females) diagnosed by using the overnight polysomnography (PSG). The patients who met the diagnostic criteria of OSAHS were recruited from the sleep laboratory of the Beijing Tongren Hospital, Capital Medical University, Key Laboratory of Otorhinolaryngology Head and Neck Surgery, Ministry of Education, China. No patients were suspected of having narcolepsy, which is an incurable disorder characterized by excessive sleepiness that typically is associated with episodes of cataplexy. In patients with OSAHS, the mean ± SD age was 50.53 ± 8.57 years; apnea/hypopnea index (AHI), 53.9 ± 16.4 events/h; and BMI, 28.32 ± 4.62 kg/m 2 , respectively.
A total of 177 healthy control subjects (113 males and 64 females) were screened for a personal or family history to exclude sleep disorders. The mean ± SD age was 48.91 ± 9.45 years; and BMI, 25.17 ± 3.63 kg/m 2 in the healthy control group. In these subjects, AHI had to be below 5/h as confirmed by PSG.
All subjects were unrelated Chinese Han individuals. Patients with OSAHS and healthy control subjects were screened to exclude definite psychiatric disorders (axis I disorders of the Diagnostic and Statistical Manual of Mental Disorders ) and taking psychotropic medication regularly. General exclusion criteria were drugs influencing the central nervous system; sleep and heart condition; and diseases such as diabetes, acute or ischemic inflammatory liver diseases, thyroid diseases, and acute or chronic renal diseases.
The study was performed in accordance with the Declaration of Helsinki and was approved by the local ethics committee. Written informed consent was given by all participants.
2.2
Polysomnography
All patients with OSAHS and control subjects underwent overnight PSG. PSG consisted of a continuous polygraphic recording electroencephalography (C3/A2, C4/A1), electrooculogram, submental electromyography, right and left anterior tibialis surface electromyography, electrocardiogram, nasal and oral airflow, thoracic and abdominal movements, and oxyhemoglobin saturation. A tracheal microphone was used to detect snoring, and sensors were used to detect the position during sleep. PSG records were interpreted manually according to standard criteria. Apnea episodes were defined as complete cessation of airflow lasting at least 10 seconds. Hypopnea was defined as at least a 50% reduction in airflow for at least 10 seconds accompanied by a reduction in S o 2 of at least 4%. AHI was defined as the number of events of apnea or hypopnea per hour during sleep time, based on the results of the overnight PSG.
2.3
Prepro-orexin gene screening
The molecular analysis of the prepro-orexin gene was performed using genomic DNA obtained from the peripheral blood by conventional methods. Mutations in the promoter, 2 exons, and exon-intron junctions of prepro-orexin gene were screened by direct sequencing (GenBank accession no. AF118885). The detailed list of primers can be found in Table 1 .
| Coding region | Forward primer | Reverse primer |
|---|---|---|
| 5′UTR | 5′TAGTGGAAAGGGCAGAAG 3′ | 5′ATTGTGACCCACTCCCAGG 3′ |
| Exon 1 | 5′ATCTTAGACTTGCCTTTGTCT 3′ | 5′CAAACACAGGCTCTTAGC 3′ |
| Exon 2 | 5′GGCGCAAAGCAAGGAGAACT3′ | 5′GAGTTCCCAGTGCAAGGCCC3′ |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
