A novel RP1truncating mutation that causes autosomal dominant retinitis pigmentosa (ADRP)





Abstract


Background


Retinitis pigmentosa (RP) is a genetically and clinically heterogeneous group of hereditary degenerative disorders affecting approximately one in every 4000 people worldwide. Abnormalities in the retina’s photoreceptors can cause night blindness or even complete vision loss. Retinitis Pigmentosa 1 (RP1), also known as the oxygen-regulated protein-1, is a microtubule-associated protein (MAP) that organizes the outer segment of the photoreceptor. Besides, mutations in the RP1 gene are associated with dominant or recessive form of RP. This study aims to identify the potential pathogenic genes in Chinese RP patients and to elucidate the association relationship between the mutant gene and the phenotypes.


Methods


Multiple ophthalmic examinations, whole-exome sequencing, sanger sequencing, and in silico analysis were performed to evaluate the clinical features and pathogenic genes in a five-generation Chinese family diagnosed with RP.


Results


Our findings revealed a novel truncating mutation c.2015_2018del p. (Lys672Argfs∗9) in RP1 that may result in the translation of a protein with deleterious effects on photoreceptors. Therefore, resulting in autosomal dominant retinitis pigmentosa (ADRP).


Conclusions


This study broaden the range of genetic mutations associated with RP1 in ADRP and make a valuable contribution to the ongoing endeavors aimed at characterizing the molecular aspects of Chinese ADRP. Future studies would pay more attention in determining the characterization of the mutantations in RP1 gene and the relationship between genotype and phenotype in RP patients.



Introduction


Retinitis pigmentosa (RP) is the prevailing inherited retinal disorder, distinguished by the gradual deterioration of rod and cone photoreceptor cells. RP is heterogeneous clinically and genetically that affects 1 in every 4000 people worldwide. RP initially manifests as night blindness and subsequently progresses to peripheral visual field constriction, ultimately resulting in central visual loss and potential legal blindness. The characteristic ocular changes in RP encompass the deposition of pigmented bone spicules in the retina, the narrowing of retinal arterioles, and the pale appearance of the optic disc. Throughout the course of RP, other visual abnormalities such as cataract, glaucoma, refractive errors, atrophy of the retinal pigment epithelium cells (RPE) and maculopathy may occur. Mutations in genes functioning mainly in the retina may result in typical RP, while mutant proteins that have functioning in diverse cells may cause syndromic RP.


As a genetic disorder, different familial RP cases show different modes of inheritance: autosomal dominant retinitis pigmentosa (ADRP, 15%–25%), autosomal recessive retinitis pigmentosa (ARRP, 5%–20%), X-linked retinitis pigmentosa (XLRP, 5%–15%) and unknown type (40%–50%) ( Fig. 1 A). At present, 75 identified genes have been recognized as contributors to RP (RetNet, the Retinal Information Network, updated March 27, 2024; https://sph.uth.edu/retnet/ ). Among these, a total of 31 distinct genes have been identified as potential causes of ADRP, with notable associations found for RHO , PRPF31 , PRPH2 , and RP1 genes in relation to RP ( Fig. 1 B). The RP1, also known as oxygen-regulated protein 1, is situated on chromosome 8q12.1. It comprises four exons and encodes a protein composed of 2156 amino acids that is primarily expressed in the retina. RP1 is a photoreceptor-specific protein that is specifically localized to the connecting cilium and axoneme of photoreceptors. Its primary role is to preserve the structural integrity of cilia and contribute to signal transduction processes within the photoreceptors ( Fig. 2 ). The RP1 also plays a vital role in outer segment orientation and the misalignment of discs caused by RP1 mutations resulting in photoreceptor cell death. Moreover, the utilization of mutant mice with targeted modifications in the RP1 gene offers valuable in vivo evidence regarding the functional role of RP1. The malformation and disorganization of photoreceptor outer segments, mislocalization of rhodopsin, and progressive degeneration of photoreceptors were observed in the RP1 ​gene knockout mice, indicating the essential role of RP1 the in morphogenesis of photoreceptor outer segments. Mutations in the RP1 gene account for approximately 5.5% of ADRP cases and 1% of ARRP cases. These mutations primarily involve truncation of the RP1 protein. However, the precise mechanism by which these RP1 truncating mutations lead to cell death remains unclear. In addition, the majority of RP1 mutations are reported on exon 4, and the symptoms caused by various mutations are diverse. Therefore, it is necessary to conduct a gene-sequencing diagnosis for RP patients. Whole exome sequencing (WES) techniques offer a robust approach for precise genetic disorder diagnosis. This method not only strengthens clinical diagnoses but also opens new avenues for gene-based therapeutic interventions. ,




Fig. 1


P ie chart illustrating the proportion of hereditary mode of retinitis pigmentosa (RP) as well as causative genes in autosomal dominant retinitis pigmentosa (ADRP). (A) The inheritance of RP consists four patterns. (B) Estimated relative contribution of genes to ADRP. ADRP: autosomal dominant retinitis pigmentosa; ARRP: autosomal recessive retinitis pigmentosa; XLRP: X-linked retinitis pigmentosa.



Fig. 2


Schematic representation of the human photoreceptors and the localization of the RP1 protein. The posterior retina is locally magnified. The cone, Müller cell, rod and retinal pigment epithelium cells (RPE) are represented in green, purple, blue and brown. The RP1 protein is located in the connecting cilium of rod (red arrow).


In this investigation, we unveiled a previously undocumented truncating mutation c.2015_2018del p. (Lys672Argfs∗9) within the RP1 gene as observed in an RP-affected Chinese family with concomitant subluxated lens and posterior subcapsular cataract. The WES analysis indicated that both affected individuals carried heterozygous mutations, whereas the normal individuals did not carry out the mutation. We further elucidated the possible functional changes caused by this mutation through bioinformatics analysis.



Materials and methods



Proband, pedigree and clinical assessment


We enrolled a Chinese family with RP spanning five generations, diagnosed based on established ophthalmological criteria, from the Second Affiliated Hospital of Zhejiang University. All procedures adhered the principles outlined in the Declaration of Helsinki. All the subjects had family history and detailed ophthalmologic examinations, including slit lamp biomicroscopy, ultrasound biomicroscopy (UBM), best corrected visual acuity (BCVA), intraocular pressure (IOP), wide angle fundus photograph, and optical coherence tomography (OCT). Written informed consent was obtained from all participants, and the ethical clearance for the consent procedure was granted by the ethics committee of the Second Affiliated Hospital of Zhejiang University.



Whole exome sequencing


WES analysis was conducted on individuals IV-3, IV-6, and V-2 following previously described protocols. Genomic DNA was extracted from peripheral leukocytes of two patients and one relative using the Blood Genome Column Medium Extraction Kit (Kangweishiji, China). The Roche Nimble Gen Seq EZ Exome Enrichment Kit V2.0 and Seq EZ Exome Enrichment Kit V2.0 capture probes (Roche, USA) were employed to prepare the whole exome DNA library. Subsequently, sequencing was performed on the Illumina NovaSeq 6000 series sequencer (PE150). Raw data underwent quality control procedures, including adapter removal, low quality reads filtering, and other quality assessments. Mapping was accomplished using the Burrows Wheeler Aligner (BWA) with the human genome reference (hg19), and mutation calling was executed using GATK software. Samtools and Pindel were used to call Single Nucleotide Polymorphisms (SNPs) and indels, respectively. The clean data were filtered according to the quality of the sequencing. Nonsynonymous substitutions and SNPs with Minor Allele Frequency (MAF) lower than 5% were filtered using SIFT. Whenever applicable, familial segregation analysis was conducted for identified mutations. Suspected candidate mutation sites were amplified using PCR and validated by Sanger sequencing analysis, utilizing the primers GCCTCTTCCTTTGGATATTTCTAACTT (forward) and TAAAGAATTTGCCCTGGTTGTAGC (reverse).



Mutation bioinformatics analysis


The identified mutation was evaluated based on the criteria outlined by the American College of Medical Genetics and Genomics (ACMG) to assess its potential pathogenicity. The loss of function of the mutation was evaluated using the PVS1 ACMG/AMP mutation criterion. Multiple sequence alignments were performed using MEGA 11 software to analyze sequence alignments. The NP_006260.1 sequence was utilized as a reference for oxygen-regulated protein 1 isoform 1 ( Homo sapiens ), NP_035413.1 for oxygen-regulated protein 1 isoform 1 ( Mus musculus ), XP_035026983.2 for oxygen-regulated protein 1 ( Hippoglossus stenolepis ), AAK58443.1 for retinitis pigmentosa 1 protein ( Canis lupus familiaris ), XP_030634220.1 for retinitis pigmentosa 1 like 1 protein ( Chanos chanos ). In addition, we applied the SOPMA tool to analyze the secondary structure of the RP1 protein.



Results


The study included a Chinese family spanning five generations, consisting of 27 members. Among them, five individuals (two affected and three unaffected) were selected for further investigation. The pedigree was consistent with autosomal dominant inheritance ( Fig. 3 ). Clinical data for the two affected members can be found in Table 1 , while genotyping results are provided in Table 2 .




Fig. 3


Pedigree of the RP patient’s family. Segregation analysis of RP1 mutation in a pedigree represents an autosomal dominant inheritance pattern. Squares and circles represent males and females respectively. Closed and open symbols indicate affected members and unaffected subjects. The arrow denotes the proband. Family history was negative for consanguinity. The slash symbol indicates that the subject was deceased. The asterisk shows the individual underwent both clinical and genetic analyses. The question mark indicates the ophthalmic history is not available.


Table 1

Clinical features of affected individuals with RP1 gene mutation in the family.





























































IV-3 IV-6
OD OS OD OS
Age (years) 56 – 61 –
Age of onset of night blindness (years) 10 – 10 –
Sex M – M –
BCVA (LogMAR) < 0.06 < 0.06 HM HM
IOP (mmHg) 22 30 11 15
C/D ratio 0.6 0.6 0.6 0.6
ACD (mm) 2.18 2.31 – –
AL (mm) 25.72 25.75 23.11 23.00

M: male; BCVA: best corrected visual acuity; LogMAR: logarithm of the Minimum Angle of Resolution; HM: hand motion; IOP: intraocular pressure; C/D ratio: cup to disc ratio; ACD: anterior chamber depth; AL: axial length.


Table 2

Genotyping Results according to the Sanger sequencing.




























Gene Nucleotide variation Genotype Clinical diagnosis
IV-3 RP1 c.2015 (exon4) _2018del (exon4) del AGAA Heterozygous Retinitis Pigmentosa
IV-6 RP1 c.2015 (exon4) _2018del (exon4) del AGAA Heterozygous Retinitis Pigmentosa
V-2 RP1 – Homozygous Normal


The index patient ( Fig. 3 , IV-3) was a 56-year-old male who reported experiencing night blindness since the age of approximately 10 years old. This individual complained of blurred vision for five years and progressive exacerbation for one year. Upon examination, his BCVA was both Finger Count/Before eye. Examination revealed the presence of posterior subcapsular cataracts, along with iridodonesis and phacodonesis, which were due to lens subluxation ( Fig. 4 A ). The shallow anterior chamber (AC) and complete closure of the anterior angle were evident ( Fig. 4 B ). Elevated IOP was observed, with readings of 22 ​mm Hg in the right eye (OD) and 30 ​mm Hg in the left eye (OS) ( Table 1 ). Elevated intraocular pressure was due to lens subluxation. Funduscopic examinations unveiled widespread bone spicule pigment deposits, retinal arteriole attenuation, waxy pallor of the optic disc, retinal atrophy, and an enlarged cup-to-disc ratio of 0.6 in both eyes (OU) ( Fig. 4 C ). As a tool reflecting RP progression, the OCT also showed the bilateral disappearance of the ellipsoid zone (EZ), and thinner retina as well as the choroid ( Fig. 4 D ).


Mar 30, 2025 | Posted by in OPHTHALMOLOGY | Comments Off on A novel RP1truncating mutation that causes autosomal dominant retinitis pigmentosa (ADRP)

Full access? Get Clinical Tree

Get Clinical Tree app for offline access